ID: 991748092

View in Genome Browser
Species Human (GRCh38)
Location 5:69767446-69767468
Sequence CTGAATGCAAAGATGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991748083_991748092 21 Left 991748083 5:69767402-69767424 CCATGGACCTTGTTCCCCCAGTA No data
Right 991748092 5:69767446-69767468 CTGAATGCAAAGATGGAATGAGG No data
991748087_991748092 5 Left 991748087 5:69767418-69767440 CCCAGTATGAACCATGAACCAGT No data
Right 991748092 5:69767446-69767468 CTGAATGCAAAGATGGAATGAGG No data
991748085_991748092 7 Left 991748085 5:69767416-69767438 CCCCCAGTATGAACCATGAACCA No data
Right 991748092 5:69767446-69767468 CTGAATGCAAAGATGGAATGAGG No data
991748084_991748092 14 Left 991748084 5:69767409-69767431 CCTTGTTCCCCCAGTATGAACCA No data
Right 991748092 5:69767446-69767468 CTGAATGCAAAGATGGAATGAGG No data
991748089_991748092 -6 Left 991748089 5:69767429-69767451 CCATGAACCAGTTGAATCTGAAT No data
Right 991748092 5:69767446-69767468 CTGAATGCAAAGATGGAATGAGG No data
991748081_991748092 26 Left 991748081 5:69767397-69767419 CCCAACCATGGACCTTGTTCCCC No data
Right 991748092 5:69767446-69767468 CTGAATGCAAAGATGGAATGAGG No data
991748082_991748092 25 Left 991748082 5:69767398-69767420 CCAACCATGGACCTTGTTCCCCC No data
Right 991748092 5:69767446-69767468 CTGAATGCAAAGATGGAATGAGG No data
991748088_991748092 4 Left 991748088 5:69767419-69767441 CCAGTATGAACCATGAACCAGTT No data
Right 991748092 5:69767446-69767468 CTGAATGCAAAGATGGAATGAGG No data
991748086_991748092 6 Left 991748086 5:69767417-69767439 CCCCAGTATGAACCATGAACCAG No data
Right 991748092 5:69767446-69767468 CTGAATGCAAAGATGGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991748092 Original CRISPR CTGAATGCAAAGATGGAATG AGG Intergenic
No off target data available for this crispr