ID: 991748710

View in Genome Browser
Species Human (GRCh38)
Location 5:69775290-69775312
Sequence CTGAATACACTAACAGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991748708_991748710 11 Left 991748708 5:69775256-69775278 CCTGAAGCAGTTTCGGCCTTTAT No data
Right 991748710 5:69775290-69775312 CTGAATACACTAACAGACAATGG No data
991748709_991748710 -5 Left 991748709 5:69775272-69775294 CCTTTATACTATGAGAGACTGAA No data
Right 991748710 5:69775290-69775312 CTGAATACACTAACAGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991748710 Original CRISPR CTGAATACACTAACAGACAA TGG Intergenic
No off target data available for this crispr