ID: 991748710 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:69775290-69775312 |
Sequence | CTGAATACACTAACAGACAA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
991748708_991748710 | 11 | Left | 991748708 | 5:69775256-69775278 | CCTGAAGCAGTTTCGGCCTTTAT | No data | ||
Right | 991748710 | 5:69775290-69775312 | CTGAATACACTAACAGACAATGG | No data | ||||
991748709_991748710 | -5 | Left | 991748709 | 5:69775272-69775294 | CCTTTATACTATGAGAGACTGAA | No data | ||
Right | 991748710 | 5:69775290-69775312 | CTGAATACACTAACAGACAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
991748710 | Original CRISPR | CTGAATACACTAACAGACAA TGG | Intergenic | ||
No off target data available for this crispr |