ID: 991750737

View in Genome Browser
Species Human (GRCh38)
Location 5:69802288-69802310
Sequence ACATTTTTACTGATGGCGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991750737_991750739 -5 Left 991750737 5:69802288-69802310 CCTTTCGCCATCAGTAAAAATGT No data
Right 991750739 5:69802306-69802328 AATGTCCTCTAATGCTTAGCCGG No data
991750737_991750741 11 Left 991750737 5:69802288-69802310 CCTTTCGCCATCAGTAAAAATGT No data
Right 991750741 5:69802322-69802344 TAGCCGGACACATGATCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991750737 Original CRISPR ACATTTTTACTGATGGCGAA AGG (reversed) Intergenic
No off target data available for this crispr