ID: 991751956

View in Genome Browser
Species Human (GRCh38)
Location 5:69816322-69816344
Sequence GTGAAGAATAGGAAAGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991751956_991751962 9 Left 991751956 5:69816322-69816344 CCTCCCCCTTTCCTATTCTTCAC No data
Right 991751962 5:69816354-69816376 AGCAAAGCTCATAGAATTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991751956 Original CRISPR GTGAAGAATAGGAAAGGGGG AGG (reversed) Intergenic
No off target data available for this crispr