ID: 991772122

View in Genome Browser
Species Human (GRCh38)
Location 5:70050132-70050154
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 2, 1: 0, 2: 2, 3: 23, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900751609 1:4401352-4401374 GTGTGAAGGTATTGGGGTTCTGG - Intergenic
903807934 1:26018692-26018714 GAATAGAAGTAGTTGGATTCTGG - Intergenic
905781142 1:40710748-40710770 GACTGATAGGATTTAGATTCGGG + Intronic
907565345 1:55429009-55429031 GAATGAGAGCATCTGGATTCAGG + Intergenic
907606587 1:55823954-55823976 GAGTGAGGGGATTTGGCTTCTGG + Intergenic
907728950 1:57047370-57047392 GTGTGAAAGTATTTGGAGATGGG + Intronic
908809991 1:67971346-67971368 GAGAGAAAGAATGTGTATTCTGG + Intergenic
911201075 1:95044160-95044182 AAGGGAAAATAGTTGGATTCTGG - Intronic
911276494 1:95866041-95866063 GAGGGAAAGTGTTGGGAGTCAGG + Intergenic
911738440 1:101362213-101362235 GAGTGAGCCTATTTGGATTTTGG - Intergenic
915718107 1:157963383-157963405 GAGTGAAAGGGATTGGATTTAGG + Intergenic
915830871 1:159128650-159128672 GAGTTAAAGTATCTAGATCCTGG - Intronic
917292869 1:173489492-173489514 GTGTGATAGTATTTGGATGAAGG - Intergenic
917340734 1:173974882-173974904 CAGTGAAGGTAAATGGATTCTGG + Intronic
920892897 1:210010281-210010303 GAATGAATGTATGTGTATTCAGG - Intronic
921885574 1:220301817-220301839 AACTGAAAGTATTTGAATCCTGG - Intergenic
923026587 1:230209287-230209309 GAGTGACTGTATTTGGAGACAGG + Intronic
924557621 1:245131127-245131149 GTGTGACAGTATTTGGAGGCGGG + Intergenic
1066026958 10:31368090-31368112 GTGGGACAGTATTTGGATTTTGG - Intronic
1066086447 10:31976538-31976560 GAGTGAGACTAGTTTGATTCTGG - Intergenic
1066199441 10:33130996-33131018 GAGTAAAAGTATCAAGATTCAGG - Intergenic
1068859161 10:61829438-61829460 CAGGGAAAGTAATTGGAATCTGG - Intergenic
1068978034 10:63032990-63033012 AAGTGAAAGGATCAGGATTCAGG + Intergenic
1070416420 10:76194254-76194276 GAGAAAAAGTTTTTGGAATCAGG + Intronic
1071378337 10:85033065-85033087 TAGTGAACCTATTTGGATTTGGG + Intergenic
1071979533 10:90989329-90989351 GAGGGAAAGGACTTGAATTCTGG + Intergenic
1072172042 10:92873747-92873769 TGGTGAAAGAAATTGGATTCTGG + Intronic
1072517730 10:96202388-96202410 CAGTGAGAGTGGTTGGATTCTGG + Intronic
1072665164 10:97387493-97387515 GATTGAAAATATTTGGAAACTGG - Intronic
1077939954 11:6830493-6830515 GAATGAAAGTGTTTTGTTTCAGG + Intergenic
1078312551 11:10259970-10259992 GAGTGAAATTAATATGATTCAGG - Intronic
1078931572 11:15915962-15915984 GAGAGGAGGTATTTGGATGCTGG - Intergenic
1079168480 11:18068993-18069015 GAGTGAAAGTACATAGCTTCAGG + Intergenic
1080526970 11:33132135-33132157 GAATGAAAGAATTTGAAATCTGG - Intronic
1084501183 11:69536351-69536373 GAGTGAAGGTATTTGGAGACAGG + Intergenic
1087062619 11:93996153-93996175 GAGTGAAAGTTTTTGCATACAGG + Intergenic
1089283315 11:117389803-117389825 GAGTGAAAGAATGTGGAATCTGG + Intronic
1090299187 11:125619937-125619959 GAGAGACAGTATATGGATTCAGG - Intronic
1093051072 12:14505508-14505530 CAGTGAAAGTATTTACATTATGG - Intronic
1093287628 12:17284191-17284213 GGCTGAAAGTATTTGATTTCTGG - Intergenic
1093779912 12:23123030-23123052 AGGTGGAAGTAGTTGGATTCTGG + Intergenic
1095041121 12:37442107-37442129 CAGTAAAAGTATTTTGAGTCTGG - Intergenic
1097258339 12:57697403-57697425 GATGGGAAGTAGTTGGATTCTGG + Intronic
1098127580 12:67316299-67316321 CAGTGGAAGTATTTGGCTACAGG + Exonic
1098159412 12:67634867-67634889 CAGTGAATGGATCTGGATTCAGG - Intergenic
1098329553 12:69338933-69338955 GAGAGCAGGGATTTGGATTCAGG - Intergenic
1099887475 12:88549439-88549461 GACTGAAAGTGGTTAGATTCTGG + Intronic
1100377405 12:94030141-94030163 GAGTGAAATTTTCTGGATTGGGG + Intergenic
1101534323 12:105603552-105603574 ATGTGATAGTATTTGGATTGGGG - Intergenic
1106316565 13:28599515-28599537 GAGGGAACACATTTGGATTCTGG + Intergenic
1106665862 13:31849790-31849812 GAGTGGAAGTTTGTTGATTCTGG - Intergenic
1108535036 13:51367277-51367299 GATTGAAAGTATTTGGAGGCGGG - Intronic
1108881147 13:55117926-55117948 AAGTGAAAGTATTTTCTTTCAGG - Intergenic
1109552834 13:63927312-63927334 GAGTGAATTTTTTTGTATTCTGG - Intergenic
1110905119 13:80877589-80877611 GAATGAAAATATTTGAAATCTGG - Intergenic
1111041105 13:82749214-82749236 GAGTAAAAATGTTTGGATTTGGG - Intergenic
1111620497 13:90718617-90718639 GAGTGAAATTATTTTGATTTGGG - Intergenic
1112761486 13:102697739-102697761 GAGTGAAAGTATTTTATTTGGGG + Intergenic
1113034325 13:106032130-106032152 GAGTGAATTTTTTTTGATTCTGG - Intergenic
1114799084 14:25751455-25751477 GTGTCAAAGTATCTGCATTCTGG - Intergenic
1115266003 14:31500835-31500857 TCTTGAAAGTACTTGGATTCAGG + Intronic
1117547902 14:56808449-56808471 GAGTGAAAGTTTCTGGCCTCGGG + Intronic
1117777934 14:59201232-59201254 GAGTGAAAGATCTTGGGTTCGGG + Intronic
1117973739 14:61278057-61278079 AAGTTAAAGTATTCTGATTCTGG - Exonic
1121988634 14:98532545-98532567 CAGTGAAAGTGATTGGACTCAGG - Intergenic
1125400906 15:39301755-39301777 GAGTGAAAATATTTGCTTTCTGG + Intergenic
1127997539 15:64162532-64162554 GAGAGAAAGGATTCGGAATCCGG + Intronic
1131268900 15:90934913-90934935 GAGAAAAAGTATCTGGATCCCGG - Intronic
1131723966 15:95202477-95202499 GATTGCAAGTCTTTGGATTTTGG + Intergenic
1133064485 16:3196298-3196320 CAGTGAAAGTTTTTGGATGAAGG + Intergenic
1133133343 16:3691971-3691993 GAGTGAAAGTGTCTGGTTTCTGG - Intronic
1137906167 16:52324286-52324308 TGGAGAAATTATTTGGATTCTGG - Intergenic
1139709137 16:68762557-68762579 GATTGAAAGTTTTAGGAATCTGG - Intronic
1140317181 16:73909972-73909994 ACATGAAAGTATTTGCATTCGGG + Intergenic
1141336245 16:83158146-83158168 GAGTGGGAGTACCTGGATTCAGG - Intronic
1141496731 16:84415292-84415314 TAGAGAAAGTATGTGGTTTCTGG - Intronic
1146125595 17:30228887-30228909 GTCTGCAAGTATTTGGACTCAGG - Intronic
1148195634 17:45710745-45710767 GGGTGAAAATATTTGAATTAGGG + Intergenic
1148511228 17:48171613-48171635 GAGGAAAAGGATTAGGATTCTGG - Intronic
1149303756 17:55328981-55329003 CAGGGAGAGAATTTGGATTCGGG - Intergenic
1149668315 17:58382056-58382078 GAGGGAAAGTATTTAGTTTCTGG - Intronic
1150601595 17:66655523-66655545 GAGAGAAAGTGGTTGGTTTCAGG - Intronic
1150984530 17:70180748-70180770 GTGAGGTAGTATTTGGATTCTGG + Intergenic
1152830252 17:82492817-82492839 GGGTGAGAGTATCTGGAATCTGG - Intergenic
1156844080 18:41643408-41643430 GAGTGAAAATATATTTATTCAGG + Intergenic
1157736716 18:50056094-50056116 GAGTGAAAGTTTTGGGTTTATGG - Intronic
1158727545 18:59987272-59987294 GAGTGACAGTATTTGGAGGTGGG + Intergenic
1159447948 18:68563587-68563609 GAGATAATGTATTTGAATTCTGG - Intergenic
1159810600 18:73014065-73014087 GTGTGAATGTATTTGGAGACAGG - Intergenic
1161799452 19:6408391-6408413 GACTGAAAATATTTGGATGCCGG - Intergenic
1164078179 19:21839655-21839677 GGGTCAAATTATTTGGTTTCTGG + Intronic
1164689799 19:30202168-30202190 GAGTGGAAGTATTTAGTTACTGG + Intergenic
1165770184 19:38375406-38375428 GAGTGGCAGGATTGGGATTCGGG + Intronic
1166068682 19:40375298-40375320 GACTAAAAGTATTTGGGTTTAGG + Intronic
925105261 2:1285496-1285518 GTGTGATAGTATTTGGGTTGGGG - Intronic
925572676 2:5328851-5328873 GAGTGAAGTTATTTGCTTTCTGG + Intergenic
928494628 2:31819524-31819546 TAGTGAAAGTAATTGGATCATGG - Intergenic
929794741 2:45050263-45050285 TAGTGTAAGAATTTGGAGTCAGG + Intergenic
931174113 2:59835577-59835599 GAGAGAAAGAACTTGGATTCAGG - Intergenic
932395414 2:71443664-71443686 AAGTTAAAATAATTGGATTCTGG + Intergenic
933424328 2:82090642-82090664 TAGTGAAGGAATTTTGATTCAGG + Intergenic
937445605 2:121955399-121955421 GAGAGACAGTATTTGGTTGCTGG + Intergenic
938178336 2:129156771-129156793 GAAAAAAAGTATATGGATTCTGG + Intergenic
939053610 2:137334841-137334863 GAGTGAAAGTAATTGTCTTATGG + Intronic
941810376 2:169749288-169749310 GAGTGGTGGTATTTTGATTCAGG - Intronic
942042267 2:172078757-172078779 GAGTGAAGCTATTTGAAGTCAGG + Intronic
943930086 2:193838180-193838202 GAGTCAGACTATTTGGGTTCAGG - Intergenic
945441232 2:209882341-209882363 GAGTGAAAGAATGGGGGTTCCGG + Intronic
945699628 2:213153269-213153291 GAGAGAAATTATTTGGGCTCAGG + Intergenic
946038262 2:216761896-216761918 CAGTGAAATTAATGGGATTCAGG + Intergenic
947589181 2:231375389-231375411 GTGTGAAAGGATGTGGATACAGG + Intergenic
947938967 2:234032083-234032105 GTATTAAAATATTTGGATTCTGG + Intergenic
948909913 2:240997934-240997956 GAGTCCCAGTATTTGAATTCAGG - Intergenic
1168936815 20:1672802-1672824 GAGGGAACGTTTTTGGAATCTGG + Intergenic
1169264331 20:4158417-4158439 GAGGAAAAGCATCTGGATTCAGG + Intronic
1169829777 20:9811521-9811543 GAGTGAAAGTAGTTGGCCTCTGG - Intronic
1170853748 20:20028869-20028891 TACTGACAATATTTGGATTCTGG - Intronic
1171535712 20:25887016-25887038 CAGTAAAAGTATTTTGAGTCTGG - Intergenic
1171572147 20:26262882-26262904 CAGTAAAAGTATTTTGAGTCTGG + Intergenic
1171805376 20:29674168-29674190 CAGTAAAAGTATTTTGAGTCTGG + Intergenic
1172328941 20:34060628-34060650 GAGTGAAGGCATTTGGTTTCAGG + Intronic
1173793826 20:45844877-45844899 GAGAGACAGGATTTGGACTCAGG + Intronic
1185136509 22:49076386-49076408 GAGTTAACATAATTGGATTCTGG - Intergenic
949518894 3:4831822-4831844 GAGAGAAAGTAATTGGATTCAGG + Intronic
949560649 3:5198863-5198885 GAATGAAATAATTTTGATTCAGG + Intronic
950990053 3:17425278-17425300 TATTCAAAGTATTTGGAATCAGG + Intronic
951227091 3:20132814-20132836 GAGTAAAATTAATTGGATTATGG + Intronic
953210031 3:40867572-40867594 GAGTGAATCTATTGAGATTCAGG - Intergenic
954566441 3:51604057-51604079 TGGTGAAAGTAGTTGGATTCAGG + Intronic
954764097 3:52898136-52898158 AAATGAAAGTGATTGGATTCAGG - Intergenic
956994729 3:74811937-74811959 AAGTGAAAGTGTTTGGATGCTGG - Intergenic
957309589 3:78502728-78502750 CAGTGAAAGTATTTGTATGAAGG - Intergenic
959835125 3:110909514-110909536 AAATGATAGTATTCGGATTCAGG + Intergenic
960714792 3:120564265-120564287 CAGTGAAAATAATTGGATTTGGG + Intergenic
962369433 3:134808591-134808613 AAAGGAAAGTATATGGATTCTGG + Intronic
962632243 3:137290033-137290055 GAGTTGAAGTATCTGGTTTCAGG - Intergenic
963563132 3:146892402-146892424 GGTTGGAAGTATTTGGATTACGG - Intergenic
963903731 3:150756804-150756826 GAGTTAATGTATGTGGACTCTGG + Intronic
965469116 3:169068312-169068334 AAGTGAAAGAATTTAGATGCAGG - Intergenic
965572793 3:170188503-170188525 TAGTAAAAGTATTTGGAGTCGGG - Intergenic
966209668 3:177440127-177440149 GAGGGAAAGTATGAGGAGTCTGG + Intergenic
966419708 3:179725403-179725425 GAGTTAAACTATTTAGATGCAGG - Intronic
966483765 3:180444800-180444822 GAGGTAAAGTAATTAGATTCTGG - Intergenic
967661551 3:192116713-192116735 GATGGAAAGTAGTTGGATTCTGG - Intergenic
971568481 4:28177794-28177816 GTGTGATAGTATTTGGAGGCAGG + Intergenic
972352169 4:38245853-38245875 GAGTGGAAGTATTTTAAGTCGGG - Intergenic
973738934 4:53901246-53901268 CAGAGATAGTATTTGGATGCAGG + Intronic
974131638 4:57763364-57763386 GACTGAGAATGTTTGGATTCTGG - Intergenic
975990785 4:80257927-80257949 GGTGGAAAGTACTTGGATTCTGG + Intergenic
978539928 4:109805525-109805547 GAGTGCAACTGTTTGGATGCTGG + Intergenic
979530817 4:121767544-121767566 GAGTGGAGGTGTGTGGATTCTGG - Intergenic
981035189 4:140161900-140161922 GTGTGATAGTATTTGGATGTGGG + Intergenic
982839249 4:160161470-160161492 GAGTGAAAGTATGTATAGTCTGG + Intergenic
984958742 4:185073264-185073286 GAGTAAAAGTTTTGAGATTCTGG + Intergenic
986048353 5:4063115-4063137 GAGTGGAAGTATATGGATCATGG + Intergenic
987562838 5:19546449-19546471 AGGTGAAAATAATTGGATTCCGG + Intronic
990327947 5:54696684-54696706 AAGTGAATGTTTTTGTATTCTGG + Intergenic
991730842 5:69586537-69586559 TAGTGAAATTATTTGGTTTCTGG - Intronic
991772122 5:70050132-70050154 GAGTGAAAGTATTTGGATTCTGG + Intronic
991807278 5:70441699-70441721 TAGTGAAATTATTTGGTTTCTGG - Intergenic
991851415 5:70925550-70925572 GAGTGAAAGTATTTGGATTCTGG + Intronic
991864108 5:71041319-71041341 TAGTGAAATTATTTGGTTTCTGG + Intronic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
993424542 5:87746959-87746981 CAGTGAAAGAATTTCTATTCAGG + Intergenic
995968237 5:117936272-117936294 GAGTGAAAGTCATTTGATTTGGG + Intergenic
998765091 5:145477755-145477777 GAGTGCAAGTATATGCATTGTGG + Intronic
998825873 5:146100822-146100844 GTGTGAATGTATTTGGAGACAGG + Intronic
1000730543 5:164829134-164829156 TAATGAAAATATTTGGATTCTGG + Intergenic
1000816880 5:165934167-165934189 GAGTTAAAGTATCTGGATAAGGG + Intergenic
1004007900 6:11653741-11653763 CAGTGATAGGATTTGGAGTCAGG + Intergenic
1005712889 6:28519315-28519337 GAGAAAAAGAGTTTGGATTCAGG + Intronic
1006561393 6:34915890-34915912 CAGAGAAAGTATTTGGTTTCAGG + Intronic
1009542364 6:64977765-64977787 GAGTGAAAGTTTTAGTAATCTGG + Intronic
1009710075 6:67307127-67307149 AGGTGAAAGTAATTGGATTATGG + Intergenic
1010323847 6:74542684-74542706 ATGTGATAGTATTTGGATTAGGG + Intergenic
1010702947 6:79074106-79074128 AAGTGAAAGGATTGGGAGTCAGG - Intronic
1011239535 6:85256262-85256284 GAGTTAAAGTATGTGAAGTCAGG - Intergenic
1011512825 6:88120163-88120185 CAATGAAAGCATTTGGTTTCAGG + Intergenic
1011870924 6:91891717-91891739 GATAAAAAGTATTTTGATTCGGG - Intergenic
1011877226 6:91976135-91976157 GTGTGAAGGTATTTGAATACAGG + Intergenic
1012529739 6:100221069-100221091 GGGTGAAATTATTTGGAGTGAGG - Intergenic
1012736170 6:102947748-102947770 GAGAGAAAATCTATGGATTCTGG + Intergenic
1013609319 6:111779302-111779324 GACTGAAAGAATTTGGCTTTTGG - Intronic
1014145347 6:117991364-117991386 GAGTGATTGTCTTTGGATTGTGG - Intronic
1014273629 6:119362541-119362563 AACTGAAAGAATTTGGAATCAGG - Intergenic
1014544715 6:122720573-122720595 GAGTGAAAATTTTTGTCTTCAGG + Intronic
1015844011 6:137498777-137498799 GAGTGATAGTGTTTGGCTTAGGG + Intergenic
1016270346 6:142281313-142281335 AATTGAGGGTATTTGGATTCTGG - Intergenic
1016272936 6:142311200-142311222 AAGTGTAAGTACTTTGATTCTGG - Intronic
1017679501 6:156849003-156849025 TAGTGAAAGTATATGGACCCAGG - Intronic
1018144872 6:160876814-160876836 AAGTGAAAGGATTTGGAGACTGG + Intergenic
1018879438 6:167862040-167862062 GTGTGAAAGTATTGGAATCCTGG + Intronic
1019267823 7:128692-128714 GAGTGAAATTCCTAGGATTCAGG - Intergenic
1021526640 7:21595430-21595452 GATTAGAAGTAGTTGGATTCTGG + Intronic
1023072979 7:36456099-36456121 GAGTGTAAGTATGTGGATTCTGG - Intergenic
1023938498 7:44755888-44755910 TGGGGAAAGTATTTGGAATCGGG + Intronic
1024536155 7:50436019-50436041 GAGAGAAAGTATGTAGGTTCAGG - Intergenic
1024757101 7:52547214-52547236 TAGTGAAATTATTTGGGTTTGGG + Intergenic
1025042503 7:55660385-55660407 GAGTGAAAGTCTTTGTAGTAAGG - Intergenic
1025287179 7:57673717-57673739 CAGTAAAAGTATTTTGAGTCTGG - Intergenic
1026413181 7:70148226-70148248 GACTTAGAGTTTTTGGATTCTGG + Intronic
1027549330 7:79571521-79571543 GAGTGGAGAGATTTGGATTCAGG - Intergenic
1027880908 7:83834838-83834860 GATTGTAAAAATTTGGATTCTGG + Intergenic
1028214227 7:88112325-88112347 GAATGAAAGAATTTGGATAGAGG + Intronic
1029874006 7:103729016-103729038 GATTGAAGGTATGTGTATTCTGG + Intronic
1032546588 7:132748871-132748893 TAGTGAAAATAGTAGGATTCTGG - Intergenic
1033781884 7:144680705-144680727 CAGTCAAACTAGTTGGATTCAGG - Intronic
1036419248 8:8580906-8580928 AAGTGAAGGTGTTTGGATTGGGG - Intergenic
1039737598 8:40349183-40349205 GATAGGAAGTGTTTGGATTCTGG + Intergenic
1041730762 8:61060376-61060398 CAGTGAAAATCTTTGGATTTTGG + Intronic
1042251994 8:66765721-66765743 GATTCAAAATATTTGGATTTTGG + Intronic
1042970550 8:74403612-74403634 CAGTAAAAGTATATGGATTATGG + Intronic
1043035698 8:75195989-75196011 GAGAGAAAGGCTTTGGATTATGG - Intergenic
1044110103 8:88262700-88262722 AAGTTAAAGTTTTTGAATTCAGG + Intronic
1045133985 8:99192320-99192342 GAGAGAAAGTATTAGGATAGAGG + Intronic
1046018654 8:108636801-108636823 AAGTGAAAGTGCTTTGATTCTGG + Intronic
1046344666 8:112906775-112906797 CAGTGAAAGAATTTGAATTTAGG - Intronic
1047912570 8:129546192-129546214 GAATGACTGTGTTTGGATTCAGG + Intergenic
1055463297 9:76539544-76539566 GAGTGAAAAGATTTTGATTTTGG - Intergenic
1055839309 9:80483200-80483222 TAGTGAAAGCTTTGGGATTCAGG - Intergenic
1055895438 9:81169124-81169146 GACTGAAAATATATGAATTCTGG - Intergenic
1058969077 9:110063831-110063853 GTGTGATGGTATTTGGATACAGG - Intronic
1059295339 9:113265300-113265322 GAGTCAATGAGTTTGGATTCTGG + Intronic
1059370589 9:113829417-113829439 GAGTGAAATTATTTGGTCTTGGG - Intergenic
1060121773 9:120998102-120998124 GAGATAAAGTATTTCGAGTCTGG - Intronic
1060783928 9:126434138-126434160 GTGTGACAGTAGTTGGATTCAGG - Intronic
1062161978 9:135085706-135085728 GAATGAAGGCATTTGGATTAGGG - Intronic
1187766553 X:22648960-22648982 GAGTGGAGGTACTAGGATTCAGG + Intergenic
1188845982 X:35073175-35073197 GAGTAAAAGAATGTGTATTCTGG + Intergenic
1198696190 X:139341083-139341105 AAGTGAAAATATTTGCAATCTGG - Intergenic
1200203952 X:154302587-154302609 GTGTGACAGTATTTGGAGGCAGG - Intronic
1202277754 Y:23142975-23142997 GAGTAAAATTATTTGCTTTCAGG - Intronic
1202287449 Y:23265792-23265814 GAGTAAAATTATTTGCTTTCAGG + Intronic
1202287614 Y:23268176-23268198 GAGTAAAATTATTTGCTTTCAGG + Intronic
1202287779 Y:23270561-23270583 GAGTAAAATTATTTGCTTTCAGG + Intronic
1202287943 Y:23272945-23272967 GAGTAAAATTATTTGCTTTCAGG + Intronic
1202288108 Y:23275329-23275351 GAGTAAAATTATTTGCTTTCAGG + Intronic
1202288273 Y:23277713-23277735 GAGTAAAATTATTTGCTTTCAGG + Intronic
1202439389 Y:24883849-24883871 GAGTAAAATTATTTGCTTTCAGG + Intronic
1202439553 Y:24886234-24886256 GAGTAAAATTATTTGCTTTCAGG + Intronic
1202439718 Y:24888619-24888641 GAGTAAAATTATTTGCTTTCAGG + Intronic
1202439883 Y:24891003-24891025 GAGTAAAATTATTTGCTTTCAGG + Intronic
1202440048 Y:24893388-24893410 GAGTAAAATTATTTGCTTTCAGG + Intronic