ID: 991772168

View in Genome Browser
Species Human (GRCh38)
Location 5:70050473-70050495
Sequence CCTTGGAAGGCTCAGGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991772162_991772168 -8 Left 991772162 5:70050458-70050480 CCTGGAAGGTTCAGGCCTTGGAA 0: 2
1: 0
2: 0
3: 11
4: 159
Right 991772168 5:70050473-70050495 CCTTGGAAGGCTCAGGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991772168 Original CRISPR CCTTGGAAGGCTCAGGGAGG TGG Intronic
No off target data available for this crispr