ID: 991780564

View in Genome Browser
Species Human (GRCh38)
Location 5:70128060-70128082
Sequence CTGCAGATAGGGGCAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991780558_991780564 2 Left 991780558 5:70128035-70128057 CCTAGGTCAGGAGATCTTAGCAA 0: 5
1: 0
2: 0
3: 17
4: 129
Right 991780564 5:70128060-70128082 CTGCAGATAGGGGCAGCAGAGGG No data
991780555_991780564 20 Left 991780555 5:70128017-70128039 CCACTGTGGGTGACAGCGCCTAG 0: 5
1: 0
2: 0
3: 5
4: 105
Right 991780564 5:70128060-70128082 CTGCAGATAGGGGCAGCAGAGGG No data
991780554_991780564 21 Left 991780554 5:70128016-70128038 CCCACTGTGGGTGACAGCGCCTA 0: 5
1: 0
2: 0
3: 5
4: 71
Right 991780564 5:70128060-70128082 CTGCAGATAGGGGCAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991780564 Original CRISPR CTGCAGATAGGGGCAGCAGA GGG Intergenic
No off target data available for this crispr