ID: 991797350

View in Genome Browser
Species Human (GRCh38)
Location 5:70318869-70318891
Sequence GTGAAGAATAGGAAAGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991797344_991797350 9 Left 991797344 5:70318837-70318859 CCTCTAATTCTATGAGCTTTGCT No data
Right 991797350 5:70318869-70318891 GTGAAGAATAGGAAAGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991797350 Original CRISPR GTGAAGAATAGGAAAGGGGG AGG Intergenic
No off target data available for this crispr