ID: 991798570

View in Genome Browser
Species Human (GRCh38)
Location 5:70332896-70332918
Sequence ACATTTTTACTGATGGCGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991798568_991798570 -5 Left 991798568 5:70332878-70332900 CCGGCTAAGCATTAGAGGACATT No data
Right 991798570 5:70332896-70332918 ACATTTTTACTGATGGCGAAAGG No data
991798566_991798570 11 Left 991798566 5:70332862-70332884 CCTGGTGATCATGTGTCCGGCTA No data
Right 991798570 5:70332896-70332918 ACATTTTTACTGATGGCGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991798570 Original CRISPR ACATTTTTACTGATGGCGAA AGG Intergenic
No off target data available for this crispr