ID: 991799672

View in Genome Browser
Species Human (GRCh38)
Location 5:70347293-70347315
Sequence CTGAATGCAAAGATGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991799669_991799672 -6 Left 991799669 5:70347276-70347298 CCATGAACCAGTTGAATCTGAAT No data
Right 991799672 5:70347293-70347315 CTGAATGCAAAGATGGAATGAGG No data
991799663_991799672 21 Left 991799663 5:70347249-70347271 CCATGGACCTTGTTCCCCCGGTA No data
Right 991799672 5:70347293-70347315 CTGAATGCAAAGATGGAATGAGG No data
991799660_991799672 26 Left 991799660 5:70347244-70347266 CCCAACCATGGACCTTGTTCCCC No data
Right 991799672 5:70347293-70347315 CTGAATGCAAAGATGGAATGAGG No data
991799664_991799672 14 Left 991799664 5:70347256-70347278 CCTTGTTCCCCCGGTATGAACCA No data
Right 991799672 5:70347293-70347315 CTGAATGCAAAGATGGAATGAGG No data
991799661_991799672 25 Left 991799661 5:70347245-70347267 CCAACCATGGACCTTGTTCCCCC No data
Right 991799672 5:70347293-70347315 CTGAATGCAAAGATGGAATGAGG No data
991799665_991799672 7 Left 991799665 5:70347263-70347285 CCCCCGGTATGAACCATGAACCA No data
Right 991799672 5:70347293-70347315 CTGAATGCAAAGATGGAATGAGG No data
991799666_991799672 6 Left 991799666 5:70347264-70347286 CCCCGGTATGAACCATGAACCAG No data
Right 991799672 5:70347293-70347315 CTGAATGCAAAGATGGAATGAGG No data
991799667_991799672 5 Left 991799667 5:70347265-70347287 CCCGGTATGAACCATGAACCAGT No data
Right 991799672 5:70347293-70347315 CTGAATGCAAAGATGGAATGAGG No data
991799668_991799672 4 Left 991799668 5:70347266-70347288 CCGGTATGAACCATGAACCAGTT No data
Right 991799672 5:70347293-70347315 CTGAATGCAAAGATGGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991799672 Original CRISPR CTGAATGCAAAGATGGAATG AGG Intergenic
No off target data available for this crispr