ID: 991800288

View in Genome Browser
Species Human (GRCh38)
Location 5:70355102-70355124
Sequence CTGAATACACTAACAGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991800287_991800288 -5 Left 991800287 5:70355084-70355106 CCTTTATACTATGAGAGACTGAA No data
Right 991800288 5:70355102-70355124 CTGAATACACTAACAGACAATGG No data
991800286_991800288 11 Left 991800286 5:70355068-70355090 CCTGAAGCAGTTTCGGCCTTTAT No data
Right 991800288 5:70355102-70355124 CTGAATACACTAACAGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991800288 Original CRISPR CTGAATACACTAACAGACAA TGG Intergenic
No off target data available for this crispr