ID: 991824052

View in Genome Browser
Species Human (GRCh38)
Location 5:70598449-70598471
Sequence CAGTAAAGATGGAGAGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991824052_991824056 16 Left 991824052 5:70598449-70598471 CCTATTTCTCTCCATCTTTACTG No data
Right 991824056 5:70598488-70598510 TTGCTGTCATTTCTGGTTGTTGG No data
991824052_991824055 9 Left 991824052 5:70598449-70598471 CCTATTTCTCTCCATCTTTACTG No data
Right 991824055 5:70598481-70598503 TTTGTTGTTGCTGTCATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991824052 Original CRISPR CAGTAAAGATGGAGAGAAAT AGG (reversed) Intergenic
No off target data available for this crispr