ID: 991825122

View in Genome Browser
Species Human (GRCh38)
Location 5:70614193-70614215
Sequence AGCAAAGCTCATAGAATTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991825122_991825125 4 Left 991825122 5:70614193-70614215 CCTCTAATTCTATGAGCTTTGCT No data
Right 991825125 5:70614220-70614242 AAATAGTGAAGAATAGGAAAGGG No data
991825122_991825128 9 Left 991825122 5:70614193-70614215 CCTCTAATTCTATGAGCTTTGCT No data
Right 991825128 5:70614225-70614247 GTGAAGAATAGGAAAGGGGGAGG No data
991825122_991825124 3 Left 991825122 5:70614193-70614215 CCTCTAATTCTATGAGCTTTGCT No data
Right 991825124 5:70614219-70614241 AAAATAGTGAAGAATAGGAAAGG No data
991825122_991825123 -2 Left 991825122 5:70614193-70614215 CCTCTAATTCTATGAGCTTTGCT No data
Right 991825123 5:70614214-70614236 CTATCAAAATAGTGAAGAATAGG No data
991825122_991825127 6 Left 991825122 5:70614193-70614215 CCTCTAATTCTATGAGCTTTGCT No data
Right 991825127 5:70614222-70614244 ATAGTGAAGAATAGGAAAGGGGG No data
991825122_991825126 5 Left 991825122 5:70614193-70614215 CCTCTAATTCTATGAGCTTTGCT No data
Right 991825126 5:70614221-70614243 AATAGTGAAGAATAGGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991825122 Original CRISPR AGCAAAGCTCATAGAATTAG AGG (reversed) Intergenic
No off target data available for this crispr