ID: 991825128

View in Genome Browser
Species Human (GRCh38)
Location 5:70614225-70614247
Sequence GTGAAGAATAGGAAAGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991825122_991825128 9 Left 991825122 5:70614193-70614215 CCTCTAATTCTATGAGCTTTGCT No data
Right 991825128 5:70614225-70614247 GTGAAGAATAGGAAAGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991825128 Original CRISPR GTGAAGAATAGGAAAGGGGG AGG Intergenic
No off target data available for this crispr