ID: 991826345

View in Genome Browser
Species Human (GRCh38)
Location 5:70628266-70628288
Sequence ACATTTTTACTGATGGCGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991826343_991826345 -5 Left 991826343 5:70628248-70628270 CCGGCTAAGCATTAGAGGACATT No data
Right 991826345 5:70628266-70628288 ACATTTTTACTGATGGCGAAAGG No data
991826341_991826345 11 Left 991826341 5:70628232-70628254 CCTGGTGATCATGTGTCCGGCTA No data
Right 991826345 5:70628266-70628288 ACATTTTTACTGATGGCGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991826345 Original CRISPR ACATTTTTACTGATGGCGAA AGG Intergenic
No off target data available for this crispr