ID: 991828312

View in Genome Browser
Species Human (GRCh38)
Location 5:70654939-70654961
Sequence CTGAATACACTAACAGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991828312_991828313 -5 Left 991828312 5:70654939-70654961 CCATTGTCTGTTAGTGTATTCAG No data
Right 991828313 5:70654957-70654979 TTCAGTCTCTCATAGTATAAAGG No data
991828312_991828314 11 Left 991828312 5:70654939-70654961 CCATTGTCTGTTAGTGTATTCAG No data
Right 991828314 5:70654973-70654995 ATAAAGGCCGAAACTGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991828312 Original CRISPR CTGAATACACTAACAGACAA TGG (reversed) Intergenic
No off target data available for this crispr