ID: 991828925

View in Genome Browser
Species Human (GRCh38)
Location 5:70662745-70662767
Sequence CTGAATGCAAAGATGGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991828925_991828929 4 Left 991828925 5:70662745-70662767 CCTCATTCCATCTTTGCATTCAG No data
Right 991828929 5:70662772-70662794 AACTGGTTCATGGTTCATACCGG No data
991828925_991828934 21 Left 991828925 5:70662745-70662767 CCTCATTCCATCTTTGCATTCAG No data
Right 991828934 5:70662789-70662811 TACCGGGGGAACAAGGTCCATGG No data
991828925_991828936 25 Left 991828925 5:70662745-70662767 CCTCATTCCATCTTTGCATTCAG No data
Right 991828936 5:70662793-70662815 GGGGGAACAAGGTCCATGGTTGG No data
991828925_991828931 6 Left 991828925 5:70662745-70662767 CCTCATTCCATCTTTGCATTCAG No data
Right 991828931 5:70662774-70662796 CTGGTTCATGGTTCATACCGGGG No data
991828925_991828932 7 Left 991828925 5:70662745-70662767 CCTCATTCCATCTTTGCATTCAG No data
Right 991828932 5:70662775-70662797 TGGTTCATGGTTCATACCGGGGG No data
991828925_991828937 26 Left 991828925 5:70662745-70662767 CCTCATTCCATCTTTGCATTCAG No data
Right 991828937 5:70662794-70662816 GGGGAACAAGGTCCATGGTTGGG No data
991828925_991828930 5 Left 991828925 5:70662745-70662767 CCTCATTCCATCTTTGCATTCAG No data
Right 991828930 5:70662773-70662795 ACTGGTTCATGGTTCATACCGGG No data
991828925_991828933 14 Left 991828925 5:70662745-70662767 CCTCATTCCATCTTTGCATTCAG No data
Right 991828933 5:70662782-70662804 TGGTTCATACCGGGGGAACAAGG No data
991828925_991828928 -6 Left 991828925 5:70662745-70662767 CCTCATTCCATCTTTGCATTCAG No data
Right 991828928 5:70662762-70662784 ATTCAGATTCAACTGGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991828925 Original CRISPR CTGAATGCAAAGATGGAATG AGG (reversed) Intergenic
No off target data available for this crispr