ID: 991830026

View in Genome Browser
Species Human (GRCh38)
Location 5:70677185-70677207
Sequence ACATTTTTACTGATGGCGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991830026_991830030 11 Left 991830026 5:70677185-70677207 CCTTTCGCCATCAGTAAAAATGT No data
Right 991830030 5:70677219-70677241 TAGCCGGACACATGATCACCAGG No data
991830026_991830028 -5 Left 991830026 5:70677185-70677207 CCTTTCGCCATCAGTAAAAATGT No data
Right 991830028 5:70677203-70677225 AATGTCCTCTAATGCTTAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991830026 Original CRISPR ACATTTTTACTGATGGCGAA AGG (reversed) Intergenic
No off target data available for this crispr