ID: 991831243

View in Genome Browser
Species Human (GRCh38)
Location 5:70691223-70691245
Sequence GTGAAGAATAGGAAAGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991831243_991831249 9 Left 991831243 5:70691223-70691245 CCTCCCCCTTTCCTATTCTTCAC No data
Right 991831249 5:70691255-70691277 AGCAAAGCTCATAGAATTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991831243 Original CRISPR GTGAAGAATAGGAAAGGGGG AGG (reversed) Intergenic
No off target data available for this crispr