ID: 991843575

View in Genome Browser
Species Human (GRCh38)
Location 5:70833507-70833529
Sequence TGGGCAGTTCCTTCACAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991843575_991843587 29 Left 991843575 5:70833507-70833529 CCAGCCTGTGAAGGAACTGCCCA No data
Right 991843587 5:70833559-70833581 CATGCCCTGGATGTGAAACATGG No data
991843575_991843586 16 Left 991843575 5:70833507-70833529 CCAGCCTGTGAAGGAACTGCCCA No data
Right 991843586 5:70833546-70833568 CCTCTTGCATTAACATGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991843575 Original CRISPR TGGGCAGTTCCTTCACAGGC TGG (reversed) Intergenic