ID: 991843577

View in Genome Browser
Species Human (GRCh38)
Location 5:70833511-70833533
Sequence GCCTTGGGCAGTTCCTTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991843577_991843586 12 Left 991843577 5:70833511-70833533 CCTGTGAAGGAACTGCCCAAGGC No data
Right 991843586 5:70833546-70833568 CCTCTTGCATTAACATGCCCTGG No data
991843577_991843587 25 Left 991843577 5:70833511-70833533 CCTGTGAAGGAACTGCCCAAGGC No data
Right 991843587 5:70833559-70833581 CATGCCCTGGATGTGAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991843577 Original CRISPR GCCTTGGGCAGTTCCTTCAC AGG (reversed) Intergenic