ID: 991843580

View in Genome Browser
Species Human (GRCh38)
Location 5:70833526-70833548
Sequence AGGTGGGCTCCCATGGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991843580_991843590 18 Left 991843580 5:70833526-70833548 CCCAAGGCCATGGGAGCCCACCT No data
Right 991843590 5:70833567-70833589 GGATGTGAAACATGGAGACAAGG No data
991843580_991843586 -3 Left 991843580 5:70833526-70833548 CCCAAGGCCATGGGAGCCCACCT No data
Right 991843586 5:70833546-70833568 CCTCTTGCATTAACATGCCCTGG No data
991843580_991843587 10 Left 991843580 5:70833526-70833548 CCCAAGGCCATGGGAGCCCACCT No data
Right 991843587 5:70833559-70833581 CATGCCCTGGATGTGAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991843580 Original CRISPR AGGTGGGCTCCCATGGCCTT GGG (reversed) Intergenic