ID: 991843581

View in Genome Browser
Species Human (GRCh38)
Location 5:70833527-70833549
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991843581_991843586 -4 Left 991843581 5:70833527-70833549 CCAAGGCCATGGGAGCCCACCTC No data
Right 991843586 5:70833546-70833568 CCTCTTGCATTAACATGCCCTGG 0: 3
1: 7
2: 107
3: 780
4: 1282
991843581_991843587 9 Left 991843581 5:70833527-70833549 CCAAGGCCATGGGAGCCCACCTC No data
Right 991843587 5:70833559-70833581 CATGCCCTGGATGTGAAACATGG No data
991843581_991843590 17 Left 991843581 5:70833527-70833549 CCAAGGCCATGGGAGCCCACCTC No data
Right 991843590 5:70833567-70833589 GGATGTGAAACATGGAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991843581 Original CRISPR GAGGTGGGCTCCCATGGCCT TGG (reversed) Intergenic