ID: 991843583

View in Genome Browser
Species Human (GRCh38)
Location 5:70833542-70833564
Sequence GGCATGTTAATGCAAGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991843583_991843590 2 Left 991843583 5:70833542-70833564 CCCACCTCTTGCATTAACATGCC No data
Right 991843590 5:70833567-70833589 GGATGTGAAACATGGAGACAAGG No data
991843583_991843587 -6 Left 991843583 5:70833542-70833564 CCCACCTCTTGCATTAACATGCC No data
Right 991843587 5:70833559-70833581 CATGCCCTGGATGTGAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991843583 Original CRISPR GGCATGTTAATGCAAGAGGT GGG (reversed) Intergenic