ID: 991843584

View in Genome Browser
Species Human (GRCh38)
Location 5:70833543-70833565
Sequence GGGCATGTTAATGCAAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991843584_991843590 1 Left 991843584 5:70833543-70833565 CCACCTCTTGCATTAACATGCCC No data
Right 991843590 5:70833567-70833589 GGATGTGAAACATGGAGACAAGG No data
991843584_991843587 -7 Left 991843584 5:70833543-70833565 CCACCTCTTGCATTAACATGCCC No data
Right 991843587 5:70833559-70833581 CATGCCCTGGATGTGAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991843584 Original CRISPR GGGCATGTTAATGCAAGAGG TGG (reversed) Intergenic
No off target data available for this crispr