ID: 991843586

View in Genome Browser
Species Human (GRCh38)
Location 5:70833546-70833568
Sequence CCTCTTGCATTAACATGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991843577_991843586 12 Left 991843577 5:70833511-70833533 CCTGTGAAGGAACTGCCCAAGGC No data
Right 991843586 5:70833546-70833568 CCTCTTGCATTAACATGCCCTGG No data
991843581_991843586 -4 Left 991843581 5:70833527-70833549 CCAAGGCCATGGGAGCCCACCTC No data
Right 991843586 5:70833546-70833568 CCTCTTGCATTAACATGCCCTGG No data
991843582_991843586 -10 Left 991843582 5:70833533-70833555 CCATGGGAGCCCACCTCTTGCAT No data
Right 991843586 5:70833546-70833568 CCTCTTGCATTAACATGCCCTGG No data
991843580_991843586 -3 Left 991843580 5:70833526-70833548 CCCAAGGCCATGGGAGCCCACCT No data
Right 991843586 5:70833546-70833568 CCTCTTGCATTAACATGCCCTGG No data
991843575_991843586 16 Left 991843575 5:70833507-70833529 CCAGCCTGTGAAGGAACTGCCCA No data
Right 991843586 5:70833546-70833568 CCTCTTGCATTAACATGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991843586 Original CRISPR CCTCTTGCATTAACATGCCC TGG Intergenic