ID: 991843587

View in Genome Browser
Species Human (GRCh38)
Location 5:70833559-70833581
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991843584_991843587 -7 Left 991843584 5:70833543-70833565 CCACCTCTTGCATTAACATGCCC No data
Right 991843587 5:70833559-70833581 CATGCCCTGGATGTGAAACATGG No data
991843582_991843587 3 Left 991843582 5:70833533-70833555 CCATGGGAGCCCACCTCTTGCAT No data
Right 991843587 5:70833559-70833581 CATGCCCTGGATGTGAAACATGG No data
991843581_991843587 9 Left 991843581 5:70833527-70833549 CCAAGGCCATGGGAGCCCACCTC No data
Right 991843587 5:70833559-70833581 CATGCCCTGGATGTGAAACATGG No data
991843577_991843587 25 Left 991843577 5:70833511-70833533 CCTGTGAAGGAACTGCCCAAGGC No data
Right 991843587 5:70833559-70833581 CATGCCCTGGATGTGAAACATGG No data
991843580_991843587 10 Left 991843580 5:70833526-70833548 CCCAAGGCCATGGGAGCCCACCT No data
Right 991843587 5:70833559-70833581 CATGCCCTGGATGTGAAACATGG No data
991843585_991843587 -10 Left 991843585 5:70833546-70833568 CCTCTTGCATTAACATGCCCTGG No data
Right 991843587 5:70833559-70833581 CATGCCCTGGATGTGAAACATGG No data
991843583_991843587 -6 Left 991843583 5:70833542-70833564 CCCACCTCTTGCATTAACATGCC No data
Right 991843587 5:70833559-70833581 CATGCCCTGGATGTGAAACATGG No data
991843575_991843587 29 Left 991843575 5:70833507-70833529 CCAGCCTGTGAAGGAACTGCCCA No data
Right 991843587 5:70833559-70833581 CATGCCCTGGATGTGAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type