ID: 991843590

View in Genome Browser
Species Human (GRCh38)
Location 5:70833567-70833589
Sequence GGATGTGAAACATGGAGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991843582_991843590 11 Left 991843582 5:70833533-70833555 CCATGGGAGCCCACCTCTTGCAT 0: 265
1: 1125
2: 1535
3: 1249
4: 967
Right 991843590 5:70833567-70833589 GGATGTGAAACATGGAGACAAGG No data
991843583_991843590 2 Left 991843583 5:70833542-70833564 CCCACCTCTTGCATTAACATGCC No data
Right 991843590 5:70833567-70833589 GGATGTGAAACATGGAGACAAGG No data
991843584_991843590 1 Left 991843584 5:70833543-70833565 CCACCTCTTGCATTAACATGCCC No data
Right 991843590 5:70833567-70833589 GGATGTGAAACATGGAGACAAGG No data
991843581_991843590 17 Left 991843581 5:70833527-70833549 CCAAGGCCATGGGAGCCCACCTC 0: 167
1: 423
2: 1290
3: 1766
4: 1804
Right 991843590 5:70833567-70833589 GGATGTGAAACATGGAGACAAGG No data
991843585_991843590 -2 Left 991843585 5:70833546-70833568 CCTCTTGCATTAACATGCCCTGG 0: 5
1: 8
2: 149
3: 860
4: 1290
Right 991843590 5:70833567-70833589 GGATGTGAAACATGGAGACAAGG No data
991843580_991843590 18 Left 991843580 5:70833526-70833548 CCCAAGGCCATGGGAGCCCACCT 0: 172
1: 442
2: 1391
3: 1823
4: 1676
Right 991843590 5:70833567-70833589 GGATGTGAAACATGGAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991843590 Original CRISPR GGATGTGAAACATGGAGACA AGG Intergenic
No off target data available for this crispr