ID: 991845583

View in Genome Browser
Species Human (GRCh38)
Location 5:70859811-70859833
Sequence CTGTAAATAGAGATTCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 5, 1: 0, 2: 2, 3: 14, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991845583_991845585 7 Left 991845583 5:70859811-70859833 CCTTCCAGAATCTCTATTTACAG 0: 5
1: 0
2: 2
3: 14
4: 181
Right 991845585 5:70859841-70859863 AGATGCAACACACCTGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991845583 Original CRISPR CTGTAAATAGAGATTCTGGA AGG (reversed) Intergenic
901599556 1:10412311-10412333 CTGAAACTAGAAATTCTAGATGG - Intronic
901762706 1:11480873-11480895 CTGAAAATGGAGATTCTGTAAGG - Intronic
903259465 1:22123464-22123486 CTGAAGGAAGAGATTCTGGAAGG + Intronic
904737037 1:32642569-32642591 ATGTTAATAGAGATTCTTTACGG - Intronic
906050084 1:42863653-42863675 CTGTAGATATAGATTCTGTGTGG - Intergenic
907644503 1:56228473-56228495 CTGTAAATAGAGCTTCGGAAAGG - Intergenic
908727486 1:67192448-67192470 CTGTAAATAGAGATAATAAAAGG - Intronic
909142163 1:71881569-71881591 TTTTAAATAAAGATTCTGCAAGG + Intronic
911498157 1:98655472-98655494 TTGTCAGTAGAGAATCTGGAGGG - Intergenic
912052671 1:105549509-105549531 TTGTAAAAAGACATTCTGAAGGG - Intergenic
912169529 1:107081682-107081704 CTGGAAATGGAGATTTGGGAAGG - Intergenic
915208648 1:154289563-154289585 ATGTTAATAGAGATTCTTTATGG + Intergenic
915556781 1:156665183-156665205 GGGTAAATATAGCTTCTGGACGG - Intergenic
915860664 1:159440872-159440894 CTTTAAATAAAGTTACTGGATGG + Intergenic
916170213 1:161996193-161996215 TTGTAAATAAAGATTCTTGTTGG - Intronic
921114721 1:212078387-212078409 ATGTGAATATAGATCCTGGATGG - Intronic
921236000 1:213131034-213131056 ATGTTAATAGAGTTTCTGGAGGG + Intronic
921561670 1:216666646-216666668 CAGATAATAGAGATTATGGATGG + Intronic
923613251 1:235514021-235514043 ATTTAATTAGAGATTTTGGATGG + Intergenic
924185232 1:241481827-241481849 GAGTAAATAGAGATGCTGCAGGG + Intergenic
1065254162 10:23848468-23848490 ATGTAAATAGAGATGCTGAGTGG - Intronic
1066301561 10:34101800-34101822 CTTTCAGTAGAGACTCTGGAGGG - Intergenic
1068385746 10:56325193-56325215 CTGTAAATAATGATCCTGTAAGG - Intergenic
1070433219 10:76361979-76362001 CTTTAAATAATGTTTCTGGAGGG - Intronic
1072512905 10:96147027-96147049 CTGTAAGCAGAGAATCTGGCAGG + Intronic
1072754401 10:98008937-98008959 CTTTAACCAGAGATTCTGGCAGG + Intronic
1075420633 10:122297927-122297949 CTTCAAATAGATATTCTGGGGGG - Intronic
1075921134 10:126214554-126214576 CTCTAAAAGAAGATTCTGGAGGG + Intronic
1076488487 10:130840001-130840023 CTGTAATTGGAGGCTCTGGAGGG + Intergenic
1078303669 11:10160370-10160392 CTGAAAATAGAGATTAGGGATGG - Intronic
1079793348 11:24767151-24767173 CTAAAAATAGAAATTTTGGAGGG - Intronic
1081388478 11:42501114-42501136 CCCAAAATAGAGATTCTTGAAGG + Intergenic
1081400604 11:42637692-42637714 CTGTACATTGAGATGCAGGATGG - Intergenic
1085438944 11:76539443-76539465 CTCTAAAGAAAGATTCTAGATGG - Intronic
1085814709 11:79725346-79725368 CTGTAAGTAGAGCTTCTGGCTGG - Intergenic
1088270023 11:108024862-108024884 CTTGAAATTGAGATTATGGAAGG - Intronic
1088908315 11:114171368-114171390 CTCCTGATAGAGATTCTGGATGG - Intronic
1089772976 11:120816474-120816496 CTGAGACTAGAGCTTCTGGAAGG - Intronic
1090589258 11:128247435-128247457 CTGTTAATTCAGATTGTGGATGG - Intergenic
1091854773 12:3730778-3730800 CTGCAAAAAGAAATCCTGGAAGG + Intronic
1096084124 12:48853948-48853970 CTTTAAATTGAGCTCCTGGAGGG + Intergenic
1097601390 12:61696992-61697014 TTGTAAAAAGAAATTCTGTATGG + Intergenic
1098086665 12:66852089-66852111 CTATAAATAGAGCTTTTGAAGGG + Intergenic
1098732024 12:74048442-74048464 ATGTAAAAGGATATTCTGGAAGG - Intergenic
1098814072 12:75135133-75135155 CTGTGGATAGGGATTCTGAAAGG - Intronic
1105476888 13:20735758-20735780 GAGTAAATAGAGACTATGGAGGG + Intronic
1106583852 13:31039796-31039818 TTCGAAATGGAGATTCTGGAGGG + Intergenic
1106627700 13:31437474-31437496 CTGTGAATACAGCTTCTGAAAGG + Intergenic
1106801121 13:33256944-33256966 CTGTATATAGTGAGTCTGTAAGG - Intronic
1109462173 13:62675510-62675532 CTGTAAATAGAAATTCTATTTGG - Intergenic
1109994359 13:70103930-70103952 CTGTAAAGACAGTTTATGGATGG + Intronic
1110820127 13:79905510-79905532 CTGTAAAAAGACATACTGGATGG - Intergenic
1110886977 13:80651990-80652012 CTGGAAAAAGAGATTTTGCAGGG + Intergenic
1112372217 13:98803987-98804009 CTTTAAAAAGAGAGACTGGATGG - Intronic
1115772292 14:36677106-36677128 TTGTAAATACGGACTCTGGATGG + Exonic
1116595142 14:46832345-46832367 CGGTCAATAGAGATGGTGGAAGG - Intergenic
1119633974 14:76258780-76258802 GTGTCAACAGAGATTCTGGGAGG + Intergenic
1120260426 14:82177677-82177699 CTGGATATAGAAATTGTGGATGG - Intergenic
1123779895 15:23615834-23615856 ATGTTAATAGAGATGCTGAATGG - Intronic
1123786890 15:23683537-23683559 CTCTAAATAGAAAGACTGGAGGG - Intergenic
1123997412 15:25728453-25728475 CTTTAAAGAGAGATTCGAGACGG + Intronic
1124318866 15:28696147-28696169 CATAAAATAGACATTCTGGATGG - Intergenic
1124454652 15:29829864-29829886 CTGTAAAAAGAAACACTGGAAGG + Intronic
1126228825 15:46301502-46301524 CAGTAAATAGAGGAGCTGGACGG - Intergenic
1127270634 15:57398344-57398366 CTGTTAATGGGGATTTTGGATGG + Intronic
1128225084 15:65995930-65995952 CTATAAATGGAGATGATGGAAGG - Intronic
1131337863 15:91567059-91567081 GTGAAAACACAGATTCTGGAAGG + Intergenic
1131601115 15:93850034-93850056 CTCCAAAAAGAGATTCTGAATGG + Intergenic
1133365455 16:5205500-5205522 CTACAAATTGAGATTCTGGCAGG + Intergenic
1136558187 16:31021417-31021439 CTGCATAAAGAAATTCTGGAAGG - Intergenic
1136588849 16:31204923-31204945 AAGGAAATGGAGATTCTGGAAGG - Intergenic
1138857848 16:60716194-60716216 CTGTAAACACAGATTTTGAAAGG - Intergenic
1140448751 16:75053091-75053113 CTATAAATAGAGCTTCAGGAAGG - Intronic
1141337754 16:83173175-83173197 TTATAACTAGAGATTCTGGCTGG - Intronic
1144171959 17:12666500-12666522 CTATGAATAGAAATTTTGGAGGG + Intronic
1146709056 17:35024985-35025007 GTGTAACAAGAGCTTCTGGAGGG - Intronic
1151770023 17:76154696-76154718 CTGTCAATGGAGGATCTGGATGG - Intronic
1155105087 18:22656011-22656033 CTGAAAATAGAGATTAAGTAAGG - Intergenic
1156109343 18:33704979-33705001 CTGTCAATAGAATTTCTGAATGG - Intronic
1156782087 18:40862748-40862770 TTATCAATGGAGATTCTGGATGG - Intergenic
1157509699 18:48262020-48262042 CTGTGACTAGATATACTGGAAGG - Intronic
1158713478 18:59857841-59857863 CTGTATGTGTAGATTCTGGAAGG + Intergenic
1159109108 18:64036043-64036065 CTGTAAAGCGAGAGTGTGGAAGG + Intergenic
1159523446 18:69556973-69556995 CTGTAAATAACTCTTCTGGATGG + Intronic
1159782197 18:72673152-72673174 CGGGAAAGAGAGCTTCTGGAAGG + Intergenic
1159880228 18:73852167-73852189 CTATAAATGGAGATTTGGGAGGG + Intergenic
1160286138 18:77545186-77545208 ATGTAAATTCAGATTCTGAAGGG - Intergenic
1160433290 18:78827095-78827117 ATGTAGATATAGATTGTGGAGGG - Intergenic
1161186915 19:2927198-2927220 CTGATGACAGAGATTCTGGAGGG + Intergenic
1164022051 19:21316474-21316496 CTGCAGATTCAGATTCTGGATGG + Intronic
925257541 2:2503004-2503026 GTGGAAGTAGAGATTCTGGGCGG + Intergenic
926080941 2:9985853-9985875 TATTAAATAGGGATTCTGGAAGG + Intronic
927482142 2:23462453-23462475 CTGTCACTAGGGAGTCTGGAGGG + Intronic
927907699 2:26872915-26872937 ATGTAAATAAAAATTCTAGAAGG - Intronic
929052215 2:37847532-37847554 CTAGAAATAGAGATTCTGATAGG + Intergenic
933024932 2:77244532-77244554 CTGAAAATAGAGATTATGGAAGG + Intronic
935586004 2:104800937-104800959 TGGTAGAAAGAGATTCTGGAAGG - Intergenic
936680359 2:114763092-114763114 CAGCAAATAGAGATTCTAGGAGG + Intronic
937321854 2:120965720-120965742 CTCTAAATAGGGATCCTGGACGG - Intronic
939519761 2:143215177-143215199 CTGAAAATGGAGATTCAGGATGG + Intronic
941521391 2:166548903-166548925 CTGGAAATAGAGAAACTTGAAGG + Intergenic
941865135 2:170326579-170326601 ATGTCAATAGAGATGATGGAGGG - Intronic
944283126 2:197921619-197921641 ATGAAAATAGAGATTTTGGTGGG - Intronic
945977302 2:216280982-216281004 CTGGAAATATTGCTTCTGGAGGG + Intronic
947559718 2:231138020-231138042 ATGTAAGAAGAGCTTCTGGAAGG - Intronic
1168797862 20:623480-623502 CTGTAAACAGAGATGCTTCAAGG + Intergenic
1168936938 20:1673740-1673762 CTGTAAATAGCTCCTCTGGAGGG - Intergenic
1168969289 20:1919718-1919740 CTGTAAATGGCTCTTCTGGAGGG + Intronic
1169397446 20:5245324-5245346 CTTTAAATTGGGATTCTGCAGGG + Intergenic
1177474971 21:21608364-21608386 CTGTGAATGAAGATTCAGGAAGG - Intergenic
1177904906 21:26963891-26963913 ATGTAAACAAAGATGCTGGAGGG - Intronic
1178487791 21:33029895-33029917 CTGTGAAGAGAGATTCTGGGTGG + Intergenic
1181685153 22:24523081-24523103 CTGCAAATAGAGATGCAGAAAGG + Intronic
1183426803 22:37744381-37744403 CTGTCAAATGAGAATCTGGAAGG + Intronic
949260082 3:2095995-2096017 GTGTAAATAGTTATTTTGGAGGG + Intergenic
949932941 3:9093717-9093739 CTTTGAAAAGAGATTTTGGATGG - Intronic
950514254 3:13453867-13453889 CTGAAAGTAAAGATTCTGGCTGG + Intergenic
950658193 3:14450314-14450336 CTCAGAATGGAGATTCTGGAAGG - Intronic
952352810 3:32556856-32556878 ATGAAAATAGAGATTGTGGTTGG - Intronic
957773673 3:84727910-84727932 CTTTAAATAGACATTCTGTTTGG - Intergenic
958111009 3:89145313-89145335 CTTTATATAGAGATTCTTCAAGG + Intronic
958952821 3:100434880-100434902 CTGTAAATTGAGAGCATGGAGGG - Intronic
960421007 3:117445150-117445172 CTGTAAAAATAGATTAAGGATGG - Intergenic
960735294 3:120772840-120772862 ATGGAAATAAAGATCCTGGAAGG - Intronic
966297552 3:178441428-178441450 CTGTTTATAGAGATTTTGGCAGG - Intronic
971450488 4:26795921-26795943 ATGTATAAAGAAATTCTGGAGGG - Intergenic
975300156 4:72780599-72780621 CTCTAAAAAGAGCTTCTGGTAGG + Intergenic
975336749 4:73186454-73186476 CTGTAAATAGACTTTTTGAAAGG - Intronic
977315169 4:95438048-95438070 CTGTAAATGGAGATCCTGTGAGG - Intronic
977504573 4:97885713-97885735 TTGTAAACATAGTTTCTGGAAGG + Intronic
979086763 4:116421659-116421681 CTGAAAGTAGAGATTTTGGAAGG - Intergenic
980233993 4:130080000-130080022 ATGTAAAGTGATATTCTGGATGG - Intergenic
980339355 4:131522853-131522875 CTTCAAATAGAGTTTCAGGAAGG - Intergenic
982483292 4:155936951-155936973 CTGTACAAAGCAATTCTGGATGG + Intronic
1202755954 4_GL000008v2_random:62647-62669 CTGAAATTAGAGCTTCTGGCTGG + Intergenic
987746144 5:21974618-21974640 CTGTAAATAGAGATTCTGGAAGG - Intronic
990958504 5:61367503-61367525 CTGTAAATCAGGACTCTGGAAGG - Intronic
991766350 5:69984728-69984750 CTGTAAATAGAGATTCTGGAAGG - Intergenic
991780968 5:70133425-70133447 CTGTAAATAGAGATTCTGGAAGG + Intergenic
991845583 5:70859811-70859833 CTGTAAATAGAGATTCTGGAAGG - Intergenic
991873414 5:71133739-71133761 CTGTAAATAGAGATTCTGGAAGG + Intergenic
992270342 5:75056331-75056353 CTGTAACTAGAGTTTCTTGGAGG - Intergenic
994066257 5:95545899-95545921 CTGGAAATTCAGATTTTGGATGG - Intronic
994503940 5:100616300-100616322 CTGTCAAAAGAGAATCTAGAAGG - Intergenic
994655167 5:102583720-102583742 GTGAAAATAAATATTCTGGAGGG - Intergenic
995644630 5:114297614-114297636 CTGTATTTAGAGTTTTTGGAGGG - Intergenic
997657619 5:135567040-135567062 CTGTAGACTGAGTTTCTGGAGGG + Intergenic
998400533 5:141846509-141846531 CTGTAATGGCAGATTCTGGAGGG + Intergenic
1000690866 5:164319354-164319376 CTGTAAAAAGAGAATATGGGAGG - Intergenic
1004117382 6:12782758-12782780 CAGAAAATATAGGTTCTGGATGG + Intronic
1005097584 6:22134537-22134559 GGCTAAACAGAGATTCTGGATGG - Intergenic
1007191921 6:40026676-40026698 CTGTAAAGGGTGATTCTGGTGGG + Intergenic
1008962007 6:57275640-57275662 CTTTAAACAGAATTTCTGGAAGG + Intergenic
1009272528 6:61631964-61631986 ATGTAAATATAGATTTTGAAAGG + Intergenic
1009933267 6:70202336-70202358 CTGCTAATAGAGCTTGTGGATGG + Intronic
1010155086 6:72783181-72783203 CTGTAGAGAGAGATGGTGGAGGG + Intronic
1012026645 6:94002455-94002477 GTGTAAGTAGAGATTGTGGTTGG + Intergenic
1014959567 6:127666643-127666665 TTGTGAATAGACCTTCTGGAAGG - Intergenic
1015697087 6:135992634-135992656 CTGTAGCTAGAGTTTGTGGATGG + Intronic
1016256819 6:142116413-142116435 CTGAAAATAGAGCTCCTTGAGGG - Intergenic
1017507870 6:155085020-155085042 CTGTAAATGGAGACTCTGGAGGG + Intronic
1017508455 6:155090593-155090615 CTTTAATTAGATATGCTGGATGG + Intronic
1022038300 7:26554874-26554896 CTGCAGATAGATATTTTGGAAGG + Intergenic
1022467056 7:30659113-30659135 ATGTAGATAGAGCTTCTGGAAGG + Intronic
1023784605 7:43693507-43693529 CTAGAAATTGAGATTGTGGAGGG - Intronic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1025240122 7:57264779-57264801 CTGTAAACATACATTCAGGATGG - Intergenic
1025522968 7:61764018-61764040 CTGCAAAGGGATATTCTGGAGGG - Intergenic
1025546721 7:62183045-62183067 CTGCAAAGGGATATTCTGGAGGG - Intergenic
1030498359 7:110328373-110328395 CTTAAAATTGAGATTATGGATGG + Intergenic
1030785655 7:113658166-113658188 ATATAAATATAGAATCTGGAAGG + Intergenic
1031124257 7:117755908-117755930 CTGGAAAGAGAGAACCTGGAGGG - Intronic
1031378894 7:121060549-121060571 CTGTATCTAGCTATTCTGGAGGG + Intronic
1032758803 7:134918121-134918143 CAGTAAATATGGATTTTGGAAGG - Intronic
1032786140 7:135201298-135201320 TTGTAATTAGAGATCCTAGAAGG + Intronic
1034577040 7:152009262-152009284 CAGTAAATCGATATCCTGGAAGG + Intronic
1039040742 8:33406334-33406356 TTGTACATAAAAATTCTGGAAGG + Intronic
1040873484 8:52125262-52125284 ATTTTTATAGAGATTCTGGAAGG - Intronic
1042187617 8:66152633-66152655 CTGTAGAAAGAGACTCAGGAGGG - Intronic
1045225745 8:100243928-100243950 CTGTAAATTGTGCATCTGGAAGG + Intronic
1046207751 8:111024216-111024238 TTCTAAGTAGATATTCTGGATGG + Intergenic
1046301496 8:112298186-112298208 CTCTACAAAGAGATTCTGGTGGG - Intronic
1049544702 8:143224883-143224905 CTGGACTTAGAGATTCTGGAGGG - Intergenic
1050176906 9:2877779-2877801 CTTTATATGGAGATTCTGGCAGG + Intergenic
1051088583 9:13380372-13380394 CTCCAAATAGATATTCTGGTAGG - Intergenic
1053053613 9:34980590-34980612 CTGCAAAGGGAGATTCTGGACGG - Exonic
1055302797 9:74899687-74899709 CTGAAAAGAGAGCTTCTAGAAGG - Intergenic
1056064433 9:82918892-82918914 AGGTAAATAAAAATTCTGGATGG + Intergenic
1057203839 9:93158895-93158917 CTACAAAAAGACATTCTGGAAGG - Intergenic
1057546455 9:96022659-96022681 CTGTTAATAGGGATGCTGAATGG + Intergenic
1058643464 9:107109025-107109047 CTGGAAGAAGAGATGCTGGAAGG - Intergenic
1059825501 9:118024126-118024148 CTTTAACTTGAGCTTCTGGAAGG - Intergenic
1060376730 9:123121176-123121198 ATGTACATACAGATTCTGCATGG + Intronic
1185768006 X:2741547-2741569 CTGGAAACAGAGTATCTGGATGG - Intergenic
1186889303 X:13944503-13944525 TTGAAAATAGAGATTTGGGAGGG + Intergenic
1187801788 X:23071820-23071842 CTGTAAATATATATCATGGAGGG - Intergenic
1188661268 X:32761795-32761817 CTGTTAATGGAAAGTCTGGAAGG - Intronic
1188948118 X:36333716-36333738 CTTGAAATGGAGATTATGGAGGG - Intronic
1193559770 X:83003540-83003562 CTAAGAATAGAGATTCTAGAGGG - Intergenic
1195811427 X:108835909-108835931 CTGGAAATGGAGATAGTGGATGG - Intergenic
1196180266 X:112681860-112681882 CTGGAATAAGAGATTCTGCAAGG + Intergenic
1197585770 X:128346148-128346170 CTGTAAATAGCCAATATGGAAGG + Intergenic