ID: 991847085

View in Genome Browser
Species Human (GRCh38)
Location 5:70882023-70882045
Sequence ACCTGTTTGCTGCAATATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 3, 1: 0, 2: 0, 3: 6, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991847085_991847088 2 Left 991847085 5:70882023-70882045 CCAGCATATTGCAGCAAACAGGT 0: 3
1: 0
2: 0
3: 6
4: 90
Right 991847088 5:70882048-70882070 AGAGTCTGGGAACAAAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991847085 Original CRISPR ACCTGTTTGCTGCAATATGC TGG (reversed) Intergenic
902826614 1:18978998-18979020 ACCTGCTTGGTGCAGGATGCTGG + Intergenic
911672708 1:100625081-100625103 ACATGTTTGCTGTAACATTCCGG + Intergenic
912432000 1:109632913-109632935 ACCTGCTTGCTGAAAGAGGCTGG - Intergenic
923032534 1:230261510-230261532 ACCTCTTTGCTCCCATATTCTGG - Intronic
924199997 1:241648822-241648844 ACATCTTTGCTGTTATATGCAGG - Intronic
1063342050 10:5275104-5275126 GGCTGTTTTCTGTAATATGCAGG - Intergenic
1063551028 10:7033383-7033405 ACCTGATTGCTGTAATAACCTGG + Intergenic
1064808186 10:19161646-19161668 ACCTGTTTAATGCAACATTCTGG + Intronic
1065050965 10:21790653-21790675 ATCTTTTTGCTGCCAGATGCAGG - Intronic
1065167898 10:22999989-23000011 ACCTAGTTCCTGGAATATGCAGG + Intronic
1074761880 10:116673187-116673209 ACCAGTTTTCTGCAACATTCAGG - Exonic
1079959688 11:26907796-26907818 ACCTGTGTGCTGAAATTTGTGGG - Intergenic
1082119472 11:48362945-48362967 AACTGGTTGGTGCAATATGGTGG + Intergenic
1082254830 11:50022217-50022239 AACTGGTTGGTGCAATATGATGG - Intergenic
1085539216 11:77251351-77251373 ACCTTTTTGCTTCCAGATGCAGG + Intronic
1087155127 11:94894549-94894571 ACCTTTTTCCTGCAATAAGGGGG + Intergenic
1087428365 11:98018824-98018846 ACCTGTTTGGGACAATATGTTGG - Intergenic
1092851256 12:12629135-12629157 ACCTTTTTGCTGAAATTGGCAGG - Intronic
1093370802 12:18362783-18362805 ACCTGTTGGCTTACATATGCTGG + Intronic
1094051054 12:26221088-26221110 ATGTGTTTGCAGCAATAGGCAGG - Intronic
1094209033 12:27870918-27870940 GCCTGTTTCCTTCAATATCCTGG + Intergenic
1097467372 12:59944075-59944097 ACCATTTTGCTCCAATATGGTGG - Intergenic
1108705829 13:52985191-52985213 CCATGTTTGATGCAATATGCTGG - Intergenic
1131417544 15:92273659-92273681 ACATGTTTGCTGCATAATGATGG + Intergenic
1131556122 15:93400941-93400963 ACCTGCTTGCAGCAAGATTCTGG + Intergenic
1131730510 15:95275063-95275085 ACCTGATTTCTGGAAAATGCAGG + Intergenic
1133139464 16:3733583-3733605 AACTGCGTGCTGCAATATACTGG + Intronic
1137477877 16:48826398-48826420 TTCTGTTTGTTTCAATATGCTGG - Intergenic
1138103519 16:54273928-54273950 ATGTGTTTGCTGGAATATGAGGG - Intergenic
1138196838 16:55058265-55058287 ACCTGCTTTCTGCAACATGGTGG + Intergenic
1141355100 16:83338307-83338329 AACTGTCAGCTGTAATATGCCGG + Intronic
1144230095 17:13193404-13193426 ACCTGTTCTCTCCAATATGGTGG + Intergenic
1144408418 17:14975050-14975072 ACTTGGTTGCTGCAAGCTGCAGG - Intergenic
1147370956 17:39992716-39992738 ACCTGTTTGCTTCAGTCTCCGGG + Intronic
1150923332 17:69506150-69506172 GCCTGTTTGCTCCAATCTACAGG - Intronic
1151026077 17:70678471-70678493 GCCTGTTTGTTGCAACAAGCAGG - Intergenic
1152996786 18:414805-414827 ACCTGTTTGCTGTGGTCTGCAGG - Intronic
1158974854 18:62702468-62702490 TGCTGTTTGCTGCCAGATGCTGG + Intergenic
1163711436 19:18849549-18849571 ACCTTTTTGCTGCTTTTTGCGGG + Intronic
925103040 2:1265815-1265837 TCCTTTCTGCTGCCATATGCAGG + Intronic
925397808 2:3549252-3549274 ACCTGTGTGCTGCTCTCTGCTGG - Intronic
930067940 2:47342155-47342177 ACTTGTTTGCTGCAGGATGCTGG + Intergenic
932942573 2:76185203-76185225 ACATGTTTTCTGCCACATGCGGG + Intergenic
933374735 2:81464960-81464982 ACCTGGTTGCTGAAATCTGTAGG + Intergenic
935404647 2:102696471-102696493 TCCTGTTTGCTCATATATGCTGG + Intronic
1170133220 20:13045167-13045189 AACTGGGTGCTGGAATATGCAGG - Intronic
1176701333 21:10054842-10054864 AACTGATTGCTTCAATGTGCTGG - Intergenic
1184201588 22:42973076-42973098 ATGTGTTTGCTGCAGTATGTGGG - Intronic
1184494331 22:44828752-44828774 ACCTGATGGCTGGAATATCCTGG - Intronic
1184529729 22:45047425-45047447 ACCTCTATGCTGCAATTTCCAGG + Intergenic
1185260176 22:49857143-49857165 ACCTGTTTGCTGCAGGGAGCAGG + Intronic
949109030 3:236307-236329 ACCTGTTTTGTGCTACATGCTGG + Intronic
952168890 3:30783110-30783132 ACAGGTTTGCTGCATTGTGCAGG + Intronic
956669938 3:71678483-71678505 ACCTTATTGCTGCAAAAGGCTGG + Exonic
961000901 3:123373371-123373393 TCCAGTTTGCTGCATTAAGCAGG - Intronic
962727857 3:138251391-138251413 AGGTGTTTGTTTCAATATGCAGG - Intronic
962732645 3:138298078-138298100 AGCTGTTTGCTGCTTTATGCAGG + Intronic
976885146 4:89973312-89973334 ACCTATTTGATGCAAGAGGCTGG + Intergenic
977704439 4:100055426-100055448 ACCTCTTTGTTGCTGTATGCAGG + Intergenic
981529775 4:145741151-145741173 ACCTTTTAGCTGTAATATTCCGG + Intronic
984209763 4:176831951-176831973 AGATGTTTGCAGCAATATTCTGG - Intergenic
984494630 4:180480732-180480754 ACCTCTTTGCTGCTATTAGCTGG + Intergenic
985445678 4:190020130-190020152 TCCTGTTTCCTGCAAAATGGGGG + Intergenic
987747673 5:21997152-21997174 ACCTGTTTGCTGCAATATGCTGG - Intronic
991767851 5:70006945-70006967 ACCTGTTTGCTGCAATATGCTGG - Intergenic
991847085 5:70882023-70882045 ACCTGTTTGCTGCAATATGCTGG - Intergenic
993610650 5:90050149-90050171 ACCTTTTTTTTGGAATATGCAGG - Intergenic
994308238 5:98234758-98234780 ATGTGTTTGCTGCAATGTGATGG + Intergenic
994619870 5:102150395-102150417 ACCTCTTAGCTGAAATAAGCAGG - Intergenic
998718354 5:144911961-144911983 ACCTGTGAGCTGTAATATTCTGG + Intergenic
1000327290 5:160182023-160182045 TCCTGTTGGCTCCAATCTGCTGG - Intergenic
1008380223 6:50832928-50832950 CCTTTTTTGCTGCATTATGCTGG - Intronic
1008650647 6:53557935-53557957 AGTTGTTTCCTTCAATATGCAGG + Intronic
1012927721 6:105284353-105284375 ACCTGTTAGGTACCATATGCAGG - Intronic
1015916615 6:138224028-138224050 ACCTGTGTGCTGGATTATTCAGG - Intronic
1021811878 7:24410285-24410307 ACCTATTTGATGGAATATGGAGG - Intergenic
1023334373 7:39152749-39152771 AGCTATTTGCTGCAACATTCTGG + Intronic
1028000986 7:85498659-85498681 AACTCTTTGCTGCAATATCATGG + Intergenic
1029170625 7:98627144-98627166 ACCTGTGAGCAGCAATGTGCAGG - Exonic
1031519132 7:122741937-122741959 ACCAGTTCGCTCCAATATCCTGG + Intronic
1033817285 7:145088548-145088570 TCATGTCTGCTGCATTATGCTGG + Intergenic
1034358775 7:150475849-150475871 ACCTCTTTGCTTCAAATTGCTGG - Intronic
1045682053 8:104672387-104672409 AAATGTTTGCTGAAATATGTGGG + Intronic
1046684987 8:117215189-117215211 ATCTTTTTCCTACAATATGCAGG + Intergenic
1050249816 9:3732978-3733000 ACTTGCTTGCTGCAGTGTGCTGG - Intergenic
1050452646 9:5799560-5799582 CCCTGTTGGCTGCAGTTTGCCGG - Intronic
1050545343 9:6704513-6704535 TCCTGTTCGCTGCGATATGCCGG + Intergenic
1052394145 9:27917264-27917286 AGCTGTTTGCTGATATATGCAGG + Intergenic
1053638476 9:40041385-40041407 AACTGATTGCTTCAATGTGCTGG - Intergenic
1053767606 9:41423807-41423829 AACTGATTGCTTCAATGTGCTGG + Intergenic
1054319272 9:63637928-63637950 AACTGATTGCTTCAATGTGCTGG - Intergenic
1054546275 9:66335323-66335345 AACTGATTGCTTCAATGTGCTGG + Intergenic
1055453414 9:76451842-76451864 ACTAGTCTGCTACAATATGCTGG - Intronic
1056710082 9:88985343-88985365 AGCTGTTTGCTGCAATAATTTGG + Intergenic
1059658640 9:116379361-116379383 CCCTGTTTTCTGCACCATGCTGG + Intronic
1202786350 9_KI270719v1_random:24925-24947 AACTGATTGCTTCAATGTGCTGG - Intergenic
1185972902 X:4684485-4684507 ACCTGTTTGCTTCCAGATGCTGG - Intergenic
1196582300 X:117392427-117392449 ACAGGGTTGCTGCAGTATGCTGG - Intergenic
1196582330 X:117392589-117392611 ACAGGGTTGCTGCAGTATGCTGG - Intergenic