ID: 991848706

View in Genome Browser
Species Human (GRCh38)
Location 5:70902006-70902028
Sequence CTGCCGGGATTACAGGCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7110
Summary {0: 2, 1: 22, 2: 1039, 3: 2620, 4: 3427}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991848706_991848712 -8 Left 991848706 5:70902006-70902028 CCTCATGCCTGTAATCCCGGCAG 0: 2
1: 22
2: 1039
3: 2620
4: 3427
Right 991848712 5:70902021-70902043 CCCGGCAGTTTGGGAGAGTCGGG 0: 2
1: 0
2: 6
3: 242
4: 8552
991848706_991848710 -9 Left 991848706 5:70902006-70902028 CCTCATGCCTGTAATCCCGGCAG 0: 2
1: 22
2: 1039
3: 2620
4: 3427
Right 991848710 5:70902020-70902042 TCCCGGCAGTTTGGGAGAGTCGG 0: 2
1: 0
2: 5
3: 143
4: 2222
991848706_991848715 29 Left 991848706 5:70902006-70902028 CCTCATGCCTGTAATCCCGGCAG 0: 2
1: 22
2: 1039
3: 2620
4: 3427
Right 991848715 5:70902058-70902080 CCAAGAGTTTGAGACCAACTTGG 0: 5
1: 290
2: 4658
3: 34876
4: 110662

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991848706 Original CRISPR CTGCCGGGATTACAGGCATG AGG (reversed) Intronic
Too many off-targets to display for this crispr