ID: 991848712

View in Genome Browser
Species Human (GRCh38)
Location 5:70902021-70902043
Sequence CCCGGCAGTTTGGGAGAGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8802
Summary {0: 2, 1: 0, 2: 6, 3: 242, 4: 8552}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991848706_991848712 -8 Left 991848706 5:70902006-70902028 CCTCATGCCTGTAATCCCGGCAG 0: 2
1: 22
2: 1039
3: 2620
4: 3427
Right 991848712 5:70902021-70902043 CCCGGCAGTTTGGGAGAGTCGGG 0: 2
1: 0
2: 6
3: 242
4: 8552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991848712 Original CRISPR CCCGGCAGTTTGGGAGAGTC GGG Intronic
Too many off-targets to display for this crispr