ID: 991851461

View in Genome Browser
Species Human (GRCh38)
Location 5:70925891-70925913
Sequence CCTTGGAAGGCTCAGGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53551
Summary {0: 2, 1: 0, 2: 82, 3: 3162, 4: 50305}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991851455_991851461 -8 Left 991851455 5:70925876-70925898 CCTGGAAGGTTCAGGCCTTGGAA 0: 2
1: 0
2: 0
3: 11
4: 159
Right 991851461 5:70925891-70925913 CCTTGGAAGGCTCAGGGAGGTGG 0: 2
1: 0
2: 82
3: 3162
4: 50305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991851461 Original CRISPR CCTTGGAAGGCTCAGGGAGG TGG Intronic
Too many off-targets to display for this crispr