ID: 991858046

View in Genome Browser
Species Human (GRCh38)
Location 5:70987356-70987378
Sequence TATATCCCAGAGAACTAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991858043_991858046 22 Left 991858043 5:70987311-70987333 CCTCAAAATAAGGTGGTATATGT 0: 3
1: 0
2: 3
3: 13
4: 189
Right 991858046 5:70987356-70987378 TATATCCCAGAGAACTAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991858046 Original CRISPR TATATCCCAGAGAACTAGGT AGG Intronic
No off target data available for this crispr