ID: 991868072

View in Genome Browser
Species Human (GRCh38)
Location 5:71083205-71083227
Sequence ATGGCTACTCCCCTTTAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991868072_991868074 1 Left 991868072 5:71083205-71083227 CCAATTTAAAGGGGAGTAGCCAT No data
Right 991868074 5:71083229-71083251 TTTATACCTTCTAAGTACAATGG 0: 2
1: 0
2: 0
3: 16
4: 253
991868072_991868076 30 Left 991868072 5:71083205-71083227 CCAATTTAAAGGGGAGTAGCCAT No data
Right 991868076 5:71083258-71083280 GATTTCATTTTAAAAAGTTCAGG 0: 2
1: 0
2: 3
3: 57
4: 572

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991868072 Original CRISPR ATGGCTACTCCCCTTTAAAT TGG (reversed) Intergenic
No off target data available for this crispr