ID: 991871204

View in Genome Browser
Species Human (GRCh38)
Location 5:71112242-71112264
Sequence TATATCCCAGAGAACTAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991871201_991871204 22 Left 991871201 5:71112197-71112219 CCTCAAAATAAGGTGGTATATGT 0: 3
1: 0
2: 3
3: 13
4: 189
Right 991871204 5:71112242-71112264 TATATCCCAGAGAACTAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991871204 Original CRISPR TATATCCCAGAGAACTAGGT AGG Intergenic
No off target data available for this crispr