ID: 991887580

View in Genome Browser
Species Human (GRCh38)
Location 5:71288736-71288758
Sequence TTCCTGTGTGCTCAGTGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991887580_991887583 7 Left 991887580 5:71288736-71288758 CCTAAACACTGAGCACACAGGAA No data
Right 991887583 5:71288766-71288788 ATGGGAACAAGACATGCTGCAGG No data
991887580_991887587 16 Left 991887580 5:71288736-71288758 CCTAAACACTGAGCACACAGGAA No data
Right 991887587 5:71288775-71288797 AGACATGCTGCAGGCTATGGGGG No data
991887580_991887588 19 Left 991887580 5:71288736-71288758 CCTAAACACTGAGCACACAGGAA No data
Right 991887588 5:71288778-71288800 CATGCTGCAGGCTATGGGGGTGG No data
991887580_991887590 21 Left 991887580 5:71288736-71288758 CCTAAACACTGAGCACACAGGAA No data
Right 991887590 5:71288780-71288802 TGCTGCAGGCTATGGGGGTGGGG No data
991887580_991887591 22 Left 991887580 5:71288736-71288758 CCTAAACACTGAGCACACAGGAA No data
Right 991887591 5:71288781-71288803 GCTGCAGGCTATGGGGGTGGGGG No data
991887580_991887584 13 Left 991887580 5:71288736-71288758 CCTAAACACTGAGCACACAGGAA No data
Right 991887584 5:71288772-71288794 ACAAGACATGCTGCAGGCTATGG No data
991887580_991887589 20 Left 991887580 5:71288736-71288758 CCTAAACACTGAGCACACAGGAA No data
Right 991887589 5:71288779-71288801 ATGCTGCAGGCTATGGGGGTGGG No data
991887580_991887592 29 Left 991887580 5:71288736-71288758 CCTAAACACTGAGCACACAGGAA No data
Right 991887592 5:71288788-71288810 GCTATGGGGGTGGGGGAGAGAGG No data
991887580_991887593 30 Left 991887580 5:71288736-71288758 CCTAAACACTGAGCACACAGGAA No data
Right 991887593 5:71288789-71288811 CTATGGGGGTGGGGGAGAGAGGG No data
991887580_991887586 15 Left 991887580 5:71288736-71288758 CCTAAACACTGAGCACACAGGAA No data
Right 991887586 5:71288774-71288796 AAGACATGCTGCAGGCTATGGGG No data
991887580_991887585 14 Left 991887580 5:71288736-71288758 CCTAAACACTGAGCACACAGGAA No data
Right 991887585 5:71288773-71288795 CAAGACATGCTGCAGGCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991887580 Original CRISPR TTCCTGTGTGCTCAGTGTTT AGG (reversed) Intergenic
No off target data available for this crispr