ID: 991887593

View in Genome Browser
Species Human (GRCh38)
Location 5:71288789-71288811
Sequence CTATGGGGGTGGGGGAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991887580_991887593 30 Left 991887580 5:71288736-71288758 CCTAAACACTGAGCACACAGGAA No data
Right 991887593 5:71288789-71288811 CTATGGGGGTGGGGGAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991887593 Original CRISPR CTATGGGGGTGGGGGAGAGA GGG Intergenic
No off target data available for this crispr