ID: 991889694

View in Genome Browser
Species Human (GRCh38)
Location 5:71318196-71318218
Sequence GTGAAGAATAGGAAAGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991889688_991889694 9 Left 991889688 5:71318164-71318186 CCTCTAATTCTATGAGCTTTGCT No data
Right 991889694 5:71318196-71318218 GTGAAGAATAGGAAAGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991889694 Original CRISPR GTGAAGAATAGGAAAGGGGG AGG Intergenic
No off target data available for this crispr