ID: 991890901

View in Genome Browser
Species Human (GRCh38)
Location 5:71332219-71332241
Sequence ACATTTTTACTGATGGCGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991890897_991890901 11 Left 991890897 5:71332185-71332207 CCTGGTGATCATGTGTCCGGCTA No data
Right 991890901 5:71332219-71332241 ACATTTTTACTGATGGCGAAAGG No data
991890899_991890901 -5 Left 991890899 5:71332201-71332223 CCGGCTAAGCATTAGAGGACATT No data
Right 991890901 5:71332219-71332241 ACATTTTTACTGATGGCGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991890901 Original CRISPR ACATTTTTACTGATGGCGAA AGG Intergenic
No off target data available for this crispr