ID: 991892030

View in Genome Browser
Species Human (GRCh38)
Location 5:71346722-71346744
Sequence CTGAATGCAAAGATGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991892019_991892030 26 Left 991892019 5:71346673-71346695 CCCAACCATGGACCTTGTTCCCC No data
Right 991892030 5:71346722-71346744 CTGAATGCAAAGATGGAATGAGG No data
991892020_991892030 25 Left 991892020 5:71346674-71346696 CCAACCATGGACCTTGTTCCCCC No data
Right 991892030 5:71346722-71346744 CTGAATGCAAAGATGGAATGAGG No data
991892023_991892030 7 Left 991892023 5:71346692-71346714 CCCCCAGTATGAACCATGAACCA No data
Right 991892030 5:71346722-71346744 CTGAATGCAAAGATGGAATGAGG No data
991892024_991892030 6 Left 991892024 5:71346693-71346715 CCCCAGTATGAACCATGAACCAG No data
Right 991892030 5:71346722-71346744 CTGAATGCAAAGATGGAATGAGG No data
991892026_991892030 4 Left 991892026 5:71346695-71346717 CCAGTATGAACCATGAACCAGTT No data
Right 991892030 5:71346722-71346744 CTGAATGCAAAGATGGAATGAGG No data
991892022_991892030 14 Left 991892022 5:71346685-71346707 CCTTGTTCCCCCAGTATGAACCA No data
Right 991892030 5:71346722-71346744 CTGAATGCAAAGATGGAATGAGG No data
991892025_991892030 5 Left 991892025 5:71346694-71346716 CCCAGTATGAACCATGAACCAGT No data
Right 991892030 5:71346722-71346744 CTGAATGCAAAGATGGAATGAGG No data
991892021_991892030 21 Left 991892021 5:71346678-71346700 CCATGGACCTTGTTCCCCCAGTA No data
Right 991892030 5:71346722-71346744 CTGAATGCAAAGATGGAATGAGG No data
991892027_991892030 -6 Left 991892027 5:71346705-71346727 CCATGAACCAGTTGAATCTGAAT No data
Right 991892030 5:71346722-71346744 CTGAATGCAAAGATGGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991892030 Original CRISPR CTGAATGCAAAGATGGAATG AGG Intergenic
No off target data available for this crispr