ID: 991900071

View in Genome Browser
Species Human (GRCh38)
Location 5:71451990-71452012
Sequence AGCAGAGGCTAGCAGTATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991900071_991900076 21 Left 991900071 5:71451990-71452012 CCTTAATACTGCTAGCCTCTGCT No data
Right 991900076 5:71452034-71452056 AAGGGAAAAGATTGACTTTCTGG No data
991900071_991900074 2 Left 991900071 5:71451990-71452012 CCTTAATACTGCTAGCCTCTGCT No data
Right 991900074 5:71452015-71452037 CACTTAGTGAAGTAACTTGAAGG No data
991900071_991900075 3 Left 991900071 5:71451990-71452012 CCTTAATACTGCTAGCCTCTGCT No data
Right 991900075 5:71452016-71452038 ACTTAGTGAAGTAACTTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991900071 Original CRISPR AGCAGAGGCTAGCAGTATTA AGG (reversed) Intergenic
No off target data available for this crispr