ID: 991909466

View in Genome Browser
Species Human (GRCh38)
Location 5:71547374-71547396
Sequence TTAGGGCAAGATTACTATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991909463_991909466 5 Left 991909463 5:71547346-71547368 CCTCATTACTAGATTCAACTTAC 0: 1
1: 0
2: 1
3: 23
4: 195
Right 991909466 5:71547374-71547396 TTAGGGCAAGATTACTATATAGG 0: 1
1: 0
2: 0
3: 9
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991909466 Original CRISPR TTAGGGCAAGATTACTATAT AGG Intronic
904881622 1:33701966-33701988 TTTGGGCAAGATAACTCCATGGG - Intronic
906644286 1:47462671-47462693 TTTGCTCAAAATTACTATATTGG - Intergenic
907145698 1:52229261-52229283 TTTTGGCAAGAATACTGTATAGG + Intronic
907942037 1:59097395-59097417 TTTGGGCATGAATACTAGATAGG + Intergenic
911701621 1:100959788-100959810 ATAGGGCATGAATACTACATAGG + Intronic
924083862 1:240427796-240427818 TTTTGGCAAAATTACTTTATAGG + Intronic
1063473599 10:6308876-6308898 TTTTGGCAAGACTACTTTATGGG - Intergenic
1064489463 10:15836259-15836281 TGAGGGCAAGTTTTCTATATGGG - Intronic
1068442344 10:57074230-57074252 TTTGGGCAAGAATACTATACAGG + Intergenic
1070271149 10:74956260-74956282 TTCTGGCAAGAATACTATATAGG + Intronic
1072297553 10:94025817-94025839 TTAGAGCAAGAAAACTATGTGGG - Intronic
1072329987 10:94338325-94338347 TTAGGGAAAGATTTCAATAAAGG + Intronic
1075508326 10:123046902-123046924 TTAGGTTAAGATTACTCTTTAGG - Intronic
1078300973 11:10132039-10132061 TTAGGTCAAGATTATTTTTTTGG + Intronic
1079896230 11:26121963-26121985 TTCATGCAGGATTACTATATGGG - Intergenic
1082038922 11:47668700-47668722 TTAGGGCAAGGTGACTAGTTAGG + Intronic
1091000067 11:131903318-131903340 TTAGGGGAAGATTCCCAAATGGG + Intronic
1097865771 12:64558069-64558091 TTTTGGCAAGCCTACTATATTGG - Intergenic
1099356933 12:81649058-81649080 TTAGAGAAAAATTTCTATATAGG + Intronic
1099617299 12:84953091-84953113 TTAAAGCAATGTTACTATATTGG + Intergenic
1100762453 12:97824140-97824162 TTAGGGCAAAATTCCAATTTTGG - Intergenic
1105422912 13:20268761-20268783 TTAGTGAATGATTAGTATATGGG + Intergenic
1106151629 13:27109337-27109359 TTAAGGCAAGAATACTTCATAGG - Intronic
1106734989 13:32579790-32579812 TTATGGCAAGATGACTACATAGG + Intergenic
1107626283 13:42288911-42288933 TTATGGCAAGAATACTTTATAGG + Intronic
1111249426 13:85584166-85584188 TTAGGGAAATATTTTTATATAGG - Intergenic
1111488614 13:88938749-88938771 TTAGAACATGATTATTATATAGG + Intergenic
1112644027 13:101308840-101308862 TTAGGGCAAGGTTAGTAGAGTGG - Intronic
1114574114 14:23696818-23696840 AAAGGACAAGATTACTGTATGGG - Intergenic
1116507486 14:45703018-45703040 TTAGGGCAGGAGTACTTTACAGG + Intergenic
1119243691 14:73084885-73084907 TTATAGCAAGAATACTATAAAGG + Intronic
1122472243 14:101977600-101977622 TTAGGGGAAAATTAGTATAAGGG - Intronic
1125904915 15:43382585-43382607 TTTTGGCAAGAATACTATGTAGG + Intronic
1126450157 15:48798912-48798934 TTAGGGTAATATTATTATATTGG - Intronic
1126717850 15:51540088-51540110 TCTGAGCAAGATTACTACATAGG - Intronic
1127853687 15:62937298-62937320 ATAGGGCAAAATTGCTAGATGGG - Intergenic
1130629365 15:85550569-85550591 AAAGGGCAAAATTACTATGTTGG - Intronic
1148662655 17:49347688-49347710 ATGGGGCAAGATTACTTAATAGG - Intronic
1155214173 18:23628497-23628519 TTAAGGAAACATTACTATAAAGG - Intronic
1156000856 18:32382379-32382401 TTGGGGCAGGATTTCTCTATTGG + Intronic
1158988446 18:62843623-62843645 TTTTGGGAGGATTACTATATTGG + Intronic
925899162 2:8496117-8496139 TTCGGGGAAGGTTACTATGTTGG - Intergenic
927744617 2:25606120-25606142 TTTCGGCAAGATTACTTCATAGG - Intronic
930083234 2:47471764-47471786 TCTGGTCAAGAATACTATATAGG - Intronic
935746058 2:106191348-106191370 GGAGGGCAAGATTACTAATTAGG + Intronic
936404482 2:112190188-112190210 TTTAGGCAAGACTACTTTATTGG + Intergenic
939417771 2:141923581-141923603 TCAGGGTAACATTACCATATAGG - Intronic
939933657 2:148261865-148261887 TTAGGCCAAGATTACTTCAATGG - Intronic
940428905 2:153564443-153564465 TCAAGACAATATTACTATATGGG - Intergenic
941888035 2:170549779-170549801 TTTAGGCAAGATCACTATATCGG + Intronic
944028817 2:195207006-195207028 TTAATGCAAGATTAGTATACTGG - Intergenic
946833361 2:223747408-223747430 TTAGTGCAAGATTATGATAGGGG - Intergenic
946978976 2:225185988-225186010 TTAGGTAAAGATTAATATTTTGG - Intergenic
1169649868 20:7855054-7855076 TGAGGGAAGGCTTACTATATAGG - Intergenic
1172679901 20:36705366-36705388 TTAGAGCAATATTACAAGATGGG - Intronic
1177284310 21:19028867-19028889 TTTAGGCATGATCACTATATGGG + Intergenic
1177326446 21:19595967-19595989 GTGGGGCAAGATTTCAATATAGG - Intergenic
1179806799 21:43844152-43844174 CAAGGCCAAGATAACTATATTGG - Intergenic
1181336070 22:22130074-22130096 TTAGTGCAAGATTACTCCTTTGG - Intergenic
1184083904 22:42246615-42246637 TGAGGGCAAGATTATGGTATTGG - Intronic
949987315 3:9551528-9551550 TTAGGGTAAGATGACTGTCTTGG + Intronic
952044360 3:29300211-29300233 TTAGGGGAATATTACTGAATAGG + Intronic
956483792 3:69699903-69699925 TTAGAGCAAGCTTACTGTATTGG - Intergenic
956945537 3:74218249-74218271 TCAGGGCTAGATAACTATGTCGG + Intergenic
957448882 3:80350250-80350272 TTTGGACAAGATTACTTCATAGG + Intergenic
957483339 3:80827165-80827187 TAAAGCCAAGAATACTATATCGG - Intergenic
960138232 3:114126923-114126945 TTATGGTAAGAATCCTATATAGG - Intergenic
960940999 3:122934357-122934379 TTCTGGCAAGATTACTTCATAGG - Intronic
961240787 3:125409359-125409381 TTTTGGCAAGACTACTTTATAGG + Intergenic
967424122 3:189306661-189306683 GTAGCTCAAAATTACTATATGGG + Intronic
970525506 4:16927993-16928015 TTAGAGCAAGAATACTTCATAGG - Intergenic
971115074 4:23636342-23636364 TTAGGTCAATAGTAATATATTGG + Intergenic
975279530 4:72544575-72544597 TCAGGGCATGATTACTACAAAGG + Intronic
976492402 4:85686941-85686963 TAATGGTAAGATTACTACATTGG - Intronic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
978451637 4:108840376-108840398 TTGGGGTAAGAGTACTATCTGGG - Intronic
980039481 4:127922973-127922995 TTTTGGCAAGAATACTTTATAGG - Intronic
982895253 4:160913286-160913308 TTACAGCAAAATTAATATATTGG - Intergenic
984306747 4:178001797-178001819 TTTGAGCAAGAATACTCTATAGG - Intergenic
990933778 5:61124415-61124437 TTATGGAAAGATTTCTATTTTGG + Intronic
991909466 5:71547374-71547396 TTAGGGCAAGATTACTATATAGG + Intronic
992489197 5:77224971-77224993 TTTGGGGAAGACTACTTTATAGG + Intronic
993656709 5:90586637-90586659 TTTGGGCAAGAATGCTACATCGG + Intronic
994252878 5:97557456-97557478 TTAGGGAAAAATTACCAGATAGG - Intergenic
995017107 5:107323264-107323286 TTAGAGCAAGAGTATTATGTGGG - Intergenic
995156053 5:108914828-108914850 TTAGGTTAAGATAAGTATATAGG + Intronic
995728020 5:115202864-115202886 TAAGGCCAAGATTTCTAAATGGG + Intergenic
995973337 5:118000698-118000720 TCAGGGCAAGATTAGAATTTTGG - Intergenic
998826797 5:146109844-146109866 TCTTGGCAAGATTACTACATAGG - Intergenic
999303355 5:150504491-150504513 TTATGGCAAGATTACGATAATGG - Intronic
999756558 5:154668955-154668977 TTAGGGCCTGATATCTATATGGG + Intergenic
1005284882 6:24314618-24314640 TTATGAGAAGATTCCTATATCGG - Intronic
1007328169 6:41079808-41079830 TTAGGCCAAGATTGATATTTTGG + Intronic
1012548099 6:100442523-100442545 TTAGTGCATGATTATTATTTTGG + Intronic
1014052426 6:116970732-116970754 TTTAAGCAAGATTACTTTATAGG + Intergenic
1014372946 6:120635890-120635912 TTAGAGCATGATTGCTAAATGGG - Intergenic
1015349634 6:132202648-132202670 TCAGGGCAACATTACTTCATAGG + Intergenic
1015782772 6:136887103-136887125 TTAGGGGAAAATTTCTAAATAGG - Intronic
1017037771 6:150281976-150281998 TTAGGGCAAGATTATAAAAATGG - Intergenic
1020436330 7:8166226-8166248 TTAGGGCTAGATTTCTCTGTGGG + Intronic
1021244630 7:18246278-18246300 TTAGGGCAAGAGCACTCTCTGGG + Intronic
1022119693 7:27296111-27296133 TTTTGGCAAGAATACTTTATGGG - Intergenic
1026277974 7:68896817-68896839 TCAGGGCAAAATTACAATAATGG - Intergenic
1029167921 7:98608089-98608111 TGCAGGCAAGACTACTATATTGG - Intergenic
1038477542 8:27878602-27878624 TGAGGGCAAGATGAATATCTGGG + Intronic
1040714791 8:50237332-50237354 TTTTGGCAAGAATACTTTATTGG + Intronic
1041837299 8:62230849-62230871 CAAGGGCAAGATTACTTCATTGG - Intergenic
1042491469 8:69403572-69403594 TTTGGGCAAGAATACAAGATTGG + Intergenic
1042791908 8:72617207-72617229 TTGGGGCAACATTAGTATACAGG - Intronic
1044101474 8:88146047-88146069 TTAAGGCAAAAGAACTATATGGG - Intronic
1044437133 8:92177480-92177502 TGATGGCAAGTTGACTATATGGG + Intergenic
1050880837 9:10698389-10698411 TTCGGGCAAAAGTACTATACTGG + Intergenic
1055119063 9:72637199-72637221 ATAGGGCCAGATTACTAAAATGG + Intronic
1055591257 9:77816896-77816918 TTAAGTCAAGATTAGTCTATTGG - Intronic
1058863651 9:109141806-109141828 TTTGGGCAGGATTACCACATAGG - Intronic
1187600726 X:20826509-20826531 TTATGGAAAGATCACTAAATTGG + Intergenic
1189961760 X:46331137-46331159 TTTTGGCAAGAATACTACATAGG + Intergenic
1190144723 X:47880050-47880072 TTTGGGCAAGAATACTTCATAGG + Intronic
1193902048 X:87192444-87192466 TTAGGCGAAGATTACTCTAGGGG + Intergenic
1200754786 Y:6980513-6980535 TTAGGAAAAGAGTAATATATAGG - Intronic