ID: 991909676

View in Genome Browser
Species Human (GRCh38)
Location 5:71549242-71549264
Sequence GTAAGTTCCCTCCTTTTTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 2, 2: 1, 3: 16, 4: 175}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991909676_991909681 -7 Left 991909676 5:71549242-71549264 CCGCAAAAAAGGAGGGAACTTAC 0: 1
1: 2
2: 1
3: 16
4: 175
Right 991909681 5:71549258-71549280 AACTTACTTCCTCAGGCTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 170
991909676_991909678 -10 Left 991909676 5:71549242-71549264 CCGCAAAAAAGGAGGGAACTTAC 0: 1
1: 2
2: 1
3: 16
4: 175
Right 991909678 5:71549255-71549277 GGGAACTTACTTCCTCAGGCTGG 0: 1
1: 0
2: 0
3: 14
4: 107
991909676_991909679 -9 Left 991909676 5:71549242-71549264 CCGCAAAAAAGGAGGGAACTTAC 0: 1
1: 2
2: 1
3: 16
4: 175
Right 991909679 5:71549256-71549278 GGAACTTACTTCCTCAGGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 107
991909676_991909688 5 Left 991909676 5:71549242-71549264 CCGCAAAAAAGGAGGGAACTTAC 0: 1
1: 2
2: 1
3: 16
4: 175
Right 991909688 5:71549270-71549292 CAGGCTGGGGGGTTGTTGGGGGG 0: 1
1: 0
2: 3
3: 69
4: 531
991909676_991909682 -6 Left 991909676 5:71549242-71549264 CCGCAAAAAAGGAGGGAACTTAC 0: 1
1: 2
2: 1
3: 16
4: 175
Right 991909682 5:71549259-71549281 ACTTACTTCCTCAGGCTGGGGGG 0: 1
1: 0
2: 3
3: 22
4: 178
991909676_991909687 4 Left 991909676 5:71549242-71549264 CCGCAAAAAAGGAGGGAACTTAC 0: 1
1: 2
2: 1
3: 16
4: 175
Right 991909687 5:71549269-71549291 TCAGGCTGGGGGGTTGTTGGGGG 0: 1
1: 0
2: 1
3: 29
4: 341
991909676_991909680 -8 Left 991909676 5:71549242-71549264 CCGCAAAAAAGGAGGGAACTTAC 0: 1
1: 2
2: 1
3: 16
4: 175
Right 991909680 5:71549257-71549279 GAACTTACTTCCTCAGGCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 141
991909676_991909686 3 Left 991909676 5:71549242-71549264 CCGCAAAAAAGGAGGGAACTTAC 0: 1
1: 2
2: 1
3: 16
4: 175
Right 991909686 5:71549268-71549290 CTCAGGCTGGGGGGTTGTTGGGG 0: 1
1: 0
2: 4
3: 28
4: 342
991909676_991909683 1 Left 991909676 5:71549242-71549264 CCGCAAAAAAGGAGGGAACTTAC 0: 1
1: 2
2: 1
3: 16
4: 175
Right 991909683 5:71549266-71549288 TCCTCAGGCTGGGGGGTTGTTGG 0: 1
1: 0
2: 0
3: 21
4: 255
991909676_991909685 2 Left 991909676 5:71549242-71549264 CCGCAAAAAAGGAGGGAACTTAC 0: 1
1: 2
2: 1
3: 16
4: 175
Right 991909685 5:71549267-71549289 CCTCAGGCTGGGGGGTTGTTGGG 0: 1
1: 0
2: 0
3: 21
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991909676 Original CRISPR GTAAGTTCCCTCCTTTTTTG CGG (reversed) Intronic
900208829 1:1443366-1443388 GTGTGTTTCCTGCTTTTTTGGGG + Intergenic
900306732 1:2013613-2013635 GTGAGTTCCCTGCTGTCTTGGGG + Intergenic
902238545 1:15073485-15073507 GTAAGTTTCCTCCCTTACTGGGG - Intronic
903313433 1:22479902-22479924 GTAAGTTCTTTGTTTTTTTGGGG + Intronic
904619991 1:31769639-31769661 ATAAGTCCCCTCCATTTTTCTGG + Intergenic
904688762 1:32278267-32278289 GTAAGATCTATCCTTTTTTCAGG + Intronic
905037437 1:34927357-34927379 GCAAGTCCCCTCCCTTCTTGGGG + Intronic
905072773 1:35242027-35242049 GGAAGGTACATCCTTTTTTGGGG - Intergenic
905683726 1:39893677-39893699 GTATTTTTCTTCCTTTTTTGAGG - Intergenic
905915751 1:41683145-41683167 GCAGGTTCCCTTCTGTTTTGGGG - Intronic
907451197 1:54547032-54547054 GCAAGTTCCCTCCTTTCTCTGGG - Intronic
909669862 1:78176462-78176484 GTAAGTGACCTCCTTTTGTCTGG + Intergenic
909690960 1:78407584-78407606 GTAAGTTCCCTATATTTTAGTGG + Intronic
914431148 1:147620869-147620891 TTAAGTCCCCCCCTGTTTTGGGG + Exonic
915238117 1:154500948-154500970 GGAAGTTCCATCATTTTCTGCGG - Intronic
915724784 1:158009585-158009607 GTGCCTTCCCTCCTTTTTCGAGG - Intronic
917592111 1:176487041-176487063 TTCAGCTCTCTCCTTTTTTGAGG - Intronic
918313205 1:183301495-183301517 GTAATTTGGCTCCTTCTTTGGGG - Intronic
919336701 1:196244756-196244778 GTAAGTTCCCTGCTTATTCTGGG - Intronic
919987956 1:202689012-202689034 GAAAGTTCCCTCCCTTGCTGAGG - Intronic
920562321 1:206947554-206947576 TTAATTTCTCTCTTTTTTTGTGG + Intergenic
921286199 1:213611546-213611568 GTAAGATCCCTCCTCTTTCCTGG - Intergenic
921412726 1:214853045-214853067 GTAAATTTCTTTCTTTTTTGGGG - Intergenic
923758464 1:236816563-236816585 GTAACTTCTTTTCTTTTTTGGGG + Intronic
1070023666 10:72610958-72610980 GTTACTTGCCTACTTTTTTGTGG - Intronic
1072855835 10:98945165-98945187 GTAAATTCACTTCTTTTTTTGGG - Intronic
1073128153 10:101165543-101165565 AGAATTTCCTTCCTTTTTTGGGG + Intergenic
1075179813 10:120200307-120200329 GTATGTTTCTTCCTATTTTGTGG + Intergenic
1075370670 10:121932211-121932233 TTTAGTTTCCTCCTTTTTGGGGG + Intergenic
1079250750 11:18785789-18785811 TAAATTGCCCTCCTTTTTTGTGG - Intronic
1079314624 11:19397165-19397187 ATCAGTTCCCTCTTTTTATGGGG - Intronic
1080176981 11:29376403-29376425 GTAAGCTAAATCCTTTTTTGGGG + Intergenic
1080185849 11:29484828-29484850 GGAAGTTTTCTCCTTGTTTGTGG + Intergenic
1082281588 11:50276514-50276536 TTAAATTCCCCCCTTTTATGTGG - Intergenic
1083506887 11:63166232-63166254 GCAAGTACCATCCCTTTTTGGGG - Exonic
1086426582 11:86689678-86689700 GTAAGTTCCGTCCTTTTTAATGG - Intergenic
1090386639 11:126361157-126361179 GTCAGTCCTCTCCTTATTTGAGG + Intronic
1094697291 12:32832770-32832792 GTAAGTTCTGGCCTCTTTTGGGG + Intronic
1095932722 12:47644743-47644765 GTAATGTCCCTCCTTGTTTTTGG - Intergenic
1100015676 12:90008117-90008139 GGAAGTTCCTTCCTATTGTGAGG + Intergenic
1101282117 12:103269051-103269073 GTCATTTCCCTCCTTGTTTGTGG - Intronic
1102611157 12:114113667-114113689 GTAAGTTCCCCCCTGGTTAGGGG - Intergenic
1104649572 12:130522008-130522030 GGAAGTGCCCTTCCTTTTTGTGG - Intronic
1105349987 13:19606319-19606341 GTAAGTTGTTTCCCTTTTTGAGG - Intergenic
1108399693 13:50027351-50027373 GTCAGTTCTCACCTTTTTTGAGG + Intergenic
1110886351 13:80641543-80641565 GTAACTTACCTACTTTTTTGTGG + Intergenic
1114780361 14:25532453-25532475 GTAAGTTCCTTCCATTTATGAGG + Intergenic
1115326550 14:32145585-32145607 GTAAGTTCCCTGATTTTTGAGGG - Intronic
1124919686 15:34013941-34013963 GTGAGTTCCCTCTGTTCTTGAGG - Intronic
1125953503 15:43774000-43774022 GTTACTTCCCTTCTTTTTTTGGG - Intronic
1130114707 15:80996709-80996731 GGAATTTCCCTTCTTTTTTATGG - Intergenic
1130135209 15:81176618-81176640 GTATGTTCCCTCTTGTTTAGCGG - Intronic
1133393141 16:5425563-5425585 GTGACTCCCCTCCTTTCTTGTGG + Intergenic
1133885921 16:9827598-9827620 TTAAGTTCCCTCAATCTTTGTGG - Intronic
1134454347 16:14383450-14383472 CCAATTTCCTTCCTTTTTTGAGG - Intergenic
1135889101 16:26341394-26341416 CTAAGCTCCTTCCTTTTCTGAGG + Intergenic
1138931853 16:61667943-61667965 CTATGTTCCCTTGTTTTTTGAGG - Intronic
1139194885 16:64907186-64907208 GTAAGTTCTCTACTTTTTTCAGG + Intergenic
1145057983 17:19715543-19715565 TTAATTCCCCTCCTTTTTTGGGG - Intronic
1150022011 17:61626349-61626371 GTAATTTCCCTCTTTTTTCCTGG + Intergenic
1152522036 17:80862375-80862397 GAAAGTTCCCTGTGTTTTTGAGG + Intronic
1155726200 18:29086864-29086886 TTAAGTTCCCATCTTCTTTGTGG - Intergenic
1157849255 18:51031697-51031719 GTAGGTTCACTCCTTTTTGCTGG + Intronic
1160335505 18:78035262-78035284 GTAATTTTCCTCTTTTTTTCTGG + Intergenic
1163766803 19:19167871-19167893 TTGAGCTCCATCCTTTTTTGAGG + Intronic
1164254368 19:23514343-23514365 GTAAGGTCCCTTCCATTTTGGGG + Intergenic
1165463499 19:35958631-35958653 GCAAGTCACCTCCTTTCTTGGGG - Intergenic
1165931471 19:39362004-39362026 GTAGATCCCCTGCTTTTTTGTGG + Intronic
932731312 2:74224099-74224121 GTAAGTCACTTCCTTTTGTGGGG + Intronic
936951088 2:117978038-117978060 GTAATTAAACTCCTTTTTTGTGG - Intronic
937209954 2:120262109-120262131 GTCACTTCCCTCATTTATTGAGG - Intronic
937811302 2:126202249-126202271 TTAAGTTCCATCTTATTTTGGGG - Intergenic
939215657 2:139235044-139235066 GTAAGTTCACAGCTTTTATGTGG - Intergenic
942239758 2:173950191-173950213 CTTTGTTCCCTTCTTTTTTGGGG - Intronic
945030367 2:205657486-205657508 GTAAGTTAACTTCTTTTGTGGGG - Intergenic
945041113 2:205744664-205744686 GCAAACTCCCTCCTTTTTTAGGG - Intronic
945297571 2:208186022-208186044 GTAAGTTCCCTTCTTCCTTTTGG + Intronic
946280184 2:218660826-218660848 GTCAATACCCTCCTTTTGTGGGG - Intronic
947361485 2:229349810-229349832 GAAAGTTTCCTCCCCTTTTGTGG - Intergenic
947821271 2:233072776-233072798 GTAAGTTTTCTCTTTTATTGTGG + Intronic
1169038547 20:2473462-2473484 GGTAGTTCCCTCCTTATCTGAGG - Intronic
1169734706 20:8825190-8825212 GTTCCTTCTCTCCTTTTTTGGGG - Intronic
1173542106 20:43861812-43861834 GAAAGTTCCTTCCTTTCTTTGGG + Intergenic
1178623994 21:34200566-34200588 GTAATTTCCTTCCTTTTTTATGG + Intergenic
1178826796 21:36024141-36024163 CCAAGTTTCCTCCTTTTCTGAGG + Intergenic
1180251212 21:46591060-46591082 ATTAATTCACTCCTTTTTTGTGG - Intergenic
1184100440 22:42339192-42339214 GTAAGTGCCCACCTTGTGTGAGG - Intronic
1185344694 22:50306177-50306199 GTAACTTCCCTCCTCTACTGGGG + Intronic
951516732 3:23567910-23567932 ATAAGTTTCCTCCTTTTTAGAGG + Intronic
952067900 3:29594201-29594223 ATCATTTCCCCCCTTTTTTGTGG + Intronic
952351950 3:32548057-32548079 GGAAATTCCTTCCTTCTTTGAGG - Intronic
952399893 3:32953687-32953709 GTGTTTTCCCTCCCTTTTTGGGG + Exonic
956856051 3:73275826-73275848 GAAAGTTCCCTTCTTTTTAAAGG + Intergenic
962090125 3:132234660-132234682 GTAAATCCCCTCCTTTTTTGTGG - Intronic
962776959 3:138670399-138670421 AAAGTTTCCCTCCTTTTTTGTGG + Intronic
966374647 3:179283644-179283666 GTAATGTCTTTCCTTTTTTGTGG - Intergenic
966507130 3:180718012-180718034 GCAATTTCCCTTCATTTTTGGGG - Intronic
967263043 3:187663482-187663504 TTACTTTCCCTCCTTGTTTGGGG + Intergenic
969438376 4:7201655-7201677 GTACGTTGCCTCCTCTTTTGGGG + Intronic
969526568 4:7706853-7706875 GTATGTCCCCTCGTTTGTTGGGG + Intronic
970249214 4:14096399-14096421 GTAAGTTACTTCTATTTTTGAGG + Intergenic
970980637 4:22092648-22092670 TTGAGTTCCCTCCTTTAGTGAGG - Intergenic
972073295 4:35051634-35051656 GTAATTTCCCTCATTTATTTTGG - Intergenic
973969708 4:56200129-56200151 GTAAGTTCTCCCTTTCTTTGTGG + Intronic
976287842 4:83387132-83387154 CTAAGGTCCCAGCTTTTTTGAGG - Intergenic
978722252 4:111924285-111924307 GTCAGTTTCTTCCTTTTATGGGG + Intergenic
980593250 4:134919436-134919458 TTAAGTTCCTTTCTTTATTGCGG + Intergenic
980787727 4:137576228-137576250 GTAAGTTCCTTTTTTTTTTTTGG + Intergenic
982867313 4:160531024-160531046 ATAATTTCTCTTCTTTTTTGAGG + Intergenic
983318229 4:166160504-166160526 CTAAGTTGTCTCTTTTTTTGGGG - Intergenic
983329642 4:166308366-166308388 GTAAGTTTCCTCTTTTATTCAGG + Intergenic
983416514 4:167462526-167462548 GTAGTTTCCCTCTTTTTTTCTGG - Intergenic
985142309 4:186854234-186854256 ATAAGTTCCATCCCTTTTTTTGG + Intergenic
986275797 5:6274144-6274166 ATAGCTTCCCTCATTTTTTGGGG - Intergenic
988596907 5:32602850-32602872 GTAACTTCCCTCCTTTTTTGGGG + Exonic
989316924 5:40091936-40091958 GTGAGTTTCCTCCCCTTTTGAGG - Intergenic
989985347 5:50690483-50690505 TTATTCTCCCTCCTTTTTTGAGG + Intronic
990197856 5:53338601-53338623 GTATGTTCCTTCCTTCTTTTTGG + Intergenic
991909676 5:71549242-71549264 GTAAGTTCCCTCCTTTTTTGCGG - Intronic
994260136 5:97648294-97648316 TTAAGGTTCCTCCTTTTTTGTGG + Intergenic
996417884 5:123229579-123229601 GTAAGTTTCCCACTTTTCTGTGG - Intergenic
998720914 5:144947788-144947810 GTAACTTGACTCCTTTATTGGGG - Intergenic
999893695 5:156005954-156005976 TTCAGTTTCCCCCTTTTTTGTGG + Intronic
1000178411 5:158782199-158782221 GAAAGTTGCCTGCATTTTTGAGG + Intronic
1000454443 5:161432380-161432402 GTGAGCTCCCTCCATTTTTGAGG + Intronic
1001800176 5:174536432-174536454 GTATGTTTTCTTCTTTTTTGAGG - Intergenic
1003229332 6:4236817-4236839 GTAAGATAACACCTTTTTTGAGG + Intergenic
1003310585 6:4966249-4966271 GGATGTTCCCTCCTATTTTGTGG - Intergenic
1005282413 6:24288045-24288067 TTTAGATCCCTCCTTTTTTTTGG - Intronic
1005761030 6:28968521-28968543 ATAATATCCCTCCTTGTTTGGGG + Intergenic
1006637541 6:35471324-35471346 CTAAGCCCCCTCCTTTTCTGAGG + Intergenic
1006880777 6:37337338-37337360 AGAATTTCCCTCCTTTTTTAAGG + Intergenic
1007031446 6:38631386-38631408 GTTAGGTTCCACCTTTTTTGAGG - Intronic
1007854168 6:44837266-44837288 GTAAGTTCCCTTCCTTCTGGAGG - Intronic
1007960974 6:45958878-45958900 GTGATGTCCCTCCCTTTTTGTGG + Intronic
1009462214 6:63927171-63927193 GTAATATCCCTACTTTTCTGCGG - Intronic
1009909655 6:69910129-69910151 GTAAGGTGCCTTATTTTTTGAGG - Intronic
1013257055 6:108397777-108397799 GCAAGTTCCATTCTTTTTTATGG + Intronic
1013918856 6:115375588-115375610 GGACATTCCCTACTTTTTTGAGG - Intergenic
1014119404 6:117705993-117706015 GTTTGTTCACTCTTTTTTTGTGG + Intronic
1014674713 6:124349295-124349317 GGAAGTTCCCGCCTTTGTAGGGG - Intronic
1016674604 6:146749445-146749467 GTACTTTCCCTCCTGTTTGGGGG - Intronic
1017502816 6:155041020-155041042 GCAAGTTCCCTATTTTTTTTTGG + Intronic
1019881919 7:3869096-3869118 GTTAGTTTCCTCTTTTTTGGGGG - Intronic
1022885828 7:34642725-34642747 GCAATTTCCCTTCCTTTTTGTGG - Intergenic
1024839020 7:53562296-53562318 GTAATTTCGCTGTTTTTTTGGGG + Intergenic
1031435830 7:121730491-121730513 CTAATTTCCCTCATTATTTGGGG - Intergenic
1031755431 7:125635953-125635975 TTGGGTTCCCTCCTATTTTGAGG - Intergenic
1032439440 7:131930892-131930914 GAAAGTTCCATCCTTATGTGGGG + Intergenic
1033674345 7:143523276-143523298 GTAAGTTTTCTGCTTTTTAGGGG - Intergenic
1033697490 7:143806171-143806193 GTAAGTTTTCTGCTTTTTAGGGG + Intergenic
1036117625 8:5975400-5975422 GAATGTTTCCTCCTTTTTTATGG - Intergenic
1036125896 8:6061718-6061740 ATGAGGTCCCTCCTTTTGTGTGG - Intergenic
1036716107 8:11125461-11125483 GTAAGCTCCCACCTGTTCTGTGG - Intronic
1036801011 8:11792044-11792066 GTAACTTCCCTCCTTTTTTGGGG + Intergenic
1039119705 8:34131633-34131655 ATAATTTCACTCTTTTTTTGTGG + Intergenic
1040856886 8:51957865-51957887 ATAAGTTACCTCCTTCTTTTAGG - Intergenic
1041055671 8:53983721-53983743 GTAAGTGCTAACCTTTTTTGTGG - Intronic
1042021351 8:64373552-64373574 GTAAGTACCATCCTTTCCTGCGG + Intergenic
1044741198 8:95328151-95328173 GTACCTGCCTTCCTTTTTTGAGG + Intergenic
1045406398 8:101870906-101870928 GAACGTTCTCTCTTTTTTTGGGG - Intronic
1045766192 8:105673537-105673559 GTAATTTTCCTTCCTTTTTGTGG - Intronic
1047889876 8:129296012-129296034 GCAAGTACTCTCCTTTATTGTGG - Intergenic
1048249009 8:132842673-132842695 ATAAGTTCCTTCCATTTTTAGGG - Exonic
1051349663 9:16186972-16186994 GTAAGTTCCATCCATTTTACTGG + Intergenic
1052847048 9:33346094-33346116 GAATGTTCCCTCCTTCCTTGGGG + Intronic
1053754450 9:41290293-41290315 CTGAGTTCCCCACTTTTTTGTGG + Intergenic
1054259968 9:62854628-62854650 CTGAGTTCCCCACTTTTTTGTGG + Intergenic
1054331802 9:63765380-63765402 CTGAGTTCCCCACTTTTTTGTGG - Intergenic
1056021785 9:82445543-82445565 ATAAGTTCCATCATTTTTGGGGG + Intergenic
1057026492 9:91737824-91737846 GTAAGTTTCCTCTCTTTTTGTGG - Intronic
1057633650 9:96742108-96742130 CTAAGTTCCCTCCATCTATGTGG - Intergenic
1058825723 9:108774560-108774582 GTAGGATCCATCCTGTTTTGTGG - Intergenic
1060306447 9:122417086-122417108 GCAAATTCCCTCCTTGTGTGGGG - Intergenic
1061522812 9:131130869-131130891 TTAAGTTGCCCACTTTTTTGGGG + Intronic
1203491500 Un_GL000224v1:109878-109900 TTAAGTTTCCTCATCTTTTGAGG + Intergenic
1203504124 Un_KI270741v1:51749-51771 TTAAGTTTCCTCATCTTTTGAGG + Intergenic
1185848334 X:3461624-3461646 GCAAGGTCCCTCCTTTGTTTGGG - Intergenic
1186851006 X:13580048-13580070 TTAATTCCCCTCCTTTTATGTGG - Intronic
1187620827 X:21052278-21052300 GTAAGTTCTAACATTTTTTGGGG - Intergenic
1188485974 X:30682921-30682943 GTAAGCTCTCTCTTTTTATGAGG + Intronic
1190445106 X:50515918-50515940 GTAAAAGCCCTCTTTTTTTGAGG - Intergenic
1192698041 X:73438712-73438734 GTATGTTTCTTCATTTTTTGAGG + Intergenic
1193168220 X:78305806-78305828 AGAATTTCCTTCCTTTTTTGTGG + Intronic
1194682277 X:96869133-96869155 GTAAATGCCCTCATTTTTGGGGG + Intronic
1195672639 X:107482612-107482634 GTAAGTTCCTTCCTGTTCTGGGG - Intergenic
1195705595 X:107735927-107735949 TTCAATTCCCTGCTTTTTTGGGG + Intronic
1195810907 X:108828505-108828527 GCAAGATCACTCTTTTTTTGGGG + Intergenic
1196216065 X:113052925-113052947 GTATGTTCCCCAGTTTTTTGAGG - Intergenic
1197808151 X:130416762-130416784 GTATGTTCCCTCCTTTATTAGGG + Intergenic
1198769435 X:140113857-140113879 GTAAGTTCATTCTTTTTTTATGG + Intergenic
1200815538 Y:7527802-7527824 GCAAGGTCCCTCCTTCTTTTGGG + Intergenic
1201320559 Y:12693886-12693908 GTAAGTTCCCTCCTCTGAAGAGG + Intergenic
1201755975 Y:17485406-17485428 GTAACTTGACTCCTTGTTTGGGG - Intergenic
1201845577 Y:18420579-18420601 GTAACTTGACTCCTTGTTTGGGG + Intergenic