ID: 991911454

View in Genome Browser
Species Human (GRCh38)
Location 5:71566577-71566599
Sequence TTTTGGGTTTGCAGGCCAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 825
Summary {0: 2, 1: 1, 2: 29, 3: 158, 4: 635}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991911448_991911454 30 Left 991911448 5:71566524-71566546 CCTCTTGGATTGATAGTATAGTA 0: 1
1: 0
2: 2
3: 8
4: 83
Right 991911454 5:71566577-71566599 TTTTGGGTTTGCAGGCCAGATGG 0: 2
1: 1
2: 29
3: 158
4: 635

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991911454 Original CRISPR TTTTGGGTTTGCAGGCCAGA TGG Exonic
900355369 1:2259260-2259282 TTTTGGGTTTGTAGGCCACATGG - Intronic
902093242 1:13921320-13921342 TTCCGGCTTTGCAGGCCAGATGG + Intergenic
902557297 1:17254442-17254464 GTTTGGGTTTGCAGGCGAGTGGG + Intronic
902904947 1:19549581-19549603 TTTAGGCTTTGCAGGCCACATGG - Intergenic
903456412 1:23490261-23490283 TTCTGGGAGTGCAGGCCAGTAGG + Intergenic
903509586 1:23865031-23865053 TTTAGGTTTTGCAGGCCATTTGG + Intronic
903882193 1:26518452-26518474 TTTAGGCTTTTCAGGCCATATGG + Intergenic
903919680 1:26790747-26790769 TTTGGGGTTTAGAGGCCTGAGGG + Exonic
904096573 1:27983124-27983146 TTTAGGCTTTGCAGGCCCTATGG + Intronic
904231490 1:29077701-29077723 TTTAGGCTTTGCAGGCTATATGG + Intronic
904299453 1:29544642-29544664 ATTGGGCTTTCCAGGCCAGATGG + Intergenic
904506761 1:30962827-30962849 TTTAGGTTTTATAGGCCAGATGG - Intronic
904596654 1:31650691-31650713 GGTTGGCTTTGAAGGCCAGAGGG - Intergenic
904912233 1:33944024-33944046 TTTTGGCCTTGCAGGCTATATGG + Intronic
904996709 1:34636901-34636923 TTTCAGCTTTGCAGGCCATATGG + Intergenic
905085241 1:35368206-35368228 TTTTGACTTTGCAGGCCATATGG - Intronic
905288719 1:36906634-36906656 TTTTGGCTTTGTGGACCAGATGG + Intronic
905613349 1:39374559-39374581 TTTTAGGTTTGCAGGGTATATGG + Intronic
905820051 1:40982042-40982064 ATTTGGGTTTGCTGACCAAATGG + Intronic
906096147 1:43225343-43225365 TTTTGGCTTTGGAGGCCATGTGG + Intronic
906676356 1:47696507-47696529 CTTTGGCTTGGCAGGCCATAAGG + Intergenic
906700479 1:47853777-47853799 TTATGGTTTTCTAGGCCAGAGGG - Intronic
907235847 1:53046774-53046796 TTTAGGCTTTGCAGGTCAGTAGG - Intronic
907485053 1:54771859-54771881 TTTAGGCTTTGCAGGCCATATGG + Intergenic
907510164 1:54952080-54952102 TTCTGGGAATGCAGGCCAGTAGG - Intergenic
907710817 1:56879131-56879153 TTTAGGCTTTGCAGGTCACAGGG - Intronic
908489094 1:64625042-64625064 TTCTGGCTTTGCAGACCATAAGG - Intronic
908574562 1:65445428-65445450 TTTGGGGTTCGAAGGACAGAAGG - Intronic
908689161 1:66757951-66757973 TTTTGGATTTGCAGGCCCTACGG - Intronic
908872837 1:68634318-68634340 TTTAGGTTTTACAGGCCATATGG + Intergenic
909342092 1:74543647-74543669 TTTTGGGTTTGGAGTAAAGAGGG - Intronic
909407331 1:75306203-75306225 TTTAGGTTTTGCAGGCCAGATGG - Intronic
910424543 1:87106955-87106977 TTTAGGCTTTGCAGCCCATACGG + Exonic
910669055 1:89754885-89754907 TTTAGGCTTTGCAGGCCATATGG - Intronic
910987160 1:93016711-93016733 AGTTGGATTTGCAGGCCAGGAGG - Intergenic
911444393 1:97972023-97972045 TTTGGGCTTTCCAGGCCATATGG + Intergenic
911626510 1:100130793-100130815 TTTAGGCTTTGCGGGCCATAAGG + Intronic
911632542 1:100199590-100199612 TTTTGGATTCCCAGGCAAGATGG + Intronic
912443967 1:109719454-109719476 TTTAGGCTTTGCAGGCCAATGGG + Intronic
912824149 1:112890094-112890116 TTTTGTGTTTTTAGGACAGACGG + Intergenic
912956346 1:114156453-114156475 GGTTGGGTTTGCAGGGCAAAGGG - Intergenic
913228658 1:116722326-116722348 TTTAGGCTTGGCAGGCCATATGG + Intergenic
913350520 1:117853379-117853401 TTTAGGCTTTGCAGGCCATATGG - Intergenic
913570679 1:120117038-120117060 TTTTGTGTTTTCAGGAGAGACGG + Intergenic
914291487 1:146278014-146278036 TTTTGTGTTTTCAGGAGAGACGG + Intergenic
914552531 1:148728797-148728819 TTTTGTGTTTTCAGGAGAGACGG + Intergenic
915889064 1:159754058-159754080 TTTTGGGTTTGGGAACCAGAAGG - Intergenic
915996678 1:160570925-160570947 CCTTGCTTTTGCAGGCCAGAAGG + Intronic
916097913 1:161367575-161367597 TTTAGGCTTTGCAGGCCAAGTGG - Exonic
916764480 1:167847095-167847117 TTTTGTGTTTGTAGGAGAGATGG + Intronic
916858095 1:168772685-168772707 TTTAGGTTTTGCAGGCCAAATGG - Intergenic
917873550 1:179264578-179264600 TTTAGGGGTTGCATGCCAGGAGG - Intergenic
918246849 1:182668144-182668166 TTTTGGGTTTGTGGGCCATATGG - Intronic
920266508 1:204727739-204727761 TTGAGGCTTTGCAGGCCATAAGG + Intergenic
923373574 1:233337152-233337174 TTTTGGTTTTGCAGCCCATATGG + Intronic
923426740 1:233877768-233877790 GTTTGAGTTTGAAGGCCAGTAGG - Intergenic
923492601 1:234497663-234497685 TTTTGGTTTTGCAAGCCATATGG + Intergenic
923553662 1:234984098-234984120 TTTGGGCTTTGCAGGCCGCATGG + Intergenic
923555372 1:234996652-234996674 TTTTGGTTTTGTGGGTCAGATGG - Intergenic
923657331 1:235929465-235929487 ATTTGGCTTTGCAGGCCCTACGG - Intergenic
923663691 1:235980268-235980290 TTCAGGTTTTGCAGGCCAGGAGG + Intronic
924583076 1:245338412-245338434 TTTTGGCTCTGCAGGCCATATGG - Intronic
1064892477 10:20193209-20193231 TTCTGGGCTTACAGGCCATATGG - Intronic
1064910150 10:20392452-20392474 ATTTGGGTTTGAAGGCTAAACGG + Intergenic
1065547960 10:26841117-26841139 TTTAGGCTTTGCATGCCATATGG - Intronic
1065947758 10:30622761-30622783 TTTAGGCTTTTCAGGCCATATGG - Intronic
1066760522 10:38743547-38743569 TTTTGGGTTGCCAGGGCAGGAGG + Intergenic
1067002998 10:42635273-42635295 TTGGGGCTTTGCAGGCCAAAAGG + Intronic
1067791907 10:49294843-49294865 TTTCAGCTTTGCAGGCCAGTGGG - Intergenic
1067792763 10:49300355-49300377 TTTCAGTTTTGCAGGCCATATGG - Intronic
1067802642 10:49369784-49369806 TTTTAAGTGTGCTGGCCAGAGGG + Intronic
1067933353 10:50585995-50586017 TTTAGGCTTTGTAGGCCATATGG + Intronic
1068046400 10:51891682-51891704 TTATAGGTTTGCAGGTCATATGG + Intronic
1069079844 10:64077050-64077072 TTTTGGCTTTGCAAGCCAAATGG + Intergenic
1069152129 10:64976231-64976253 TTTAGGCATTGCAGGCCATAAGG + Intergenic
1069373666 10:67772242-67772264 TTTAGGTGTTGCAGGCCATATGG + Intergenic
1069536848 10:69260034-69260056 TTTAGGTTTTGCAGGCCATATGG + Intronic
1070006799 10:72432514-72432536 TTTTGGTTCTGCAGGCTATAGGG + Intronic
1070225703 10:74503155-74503177 TTTTAGGTTTGCAGGCCACATGG - Intronic
1070473503 10:76809318-76809340 TTTCAGCTTTGCAGGCCATATGG + Intergenic
1071348610 10:84716831-84716853 TTAAGGCTTTGCAGGCCATAAGG + Intergenic
1071709718 10:88038282-88038304 TTTAGGCTTTACAGGCCATATGG + Intergenic
1071734247 10:88280588-88280610 TTTAGATTTTGCAGGCCATATGG + Intronic
1071850936 10:89569719-89569741 TTTTGGGAGGCCAGGCCAGAAGG + Intergenic
1072434067 10:95399439-95399461 TTTAGACTTTGCAGGCCATATGG - Intronic
1072533299 10:96339678-96339700 TTTTGGGATTTGAGGCCAGTGGG - Intergenic
1072889472 10:99309684-99309706 TTTAGGCTTTGCAGGCCATATGG - Intergenic
1073634585 10:105184172-105184194 TTTAGGCTTTGCTGGCCATAGGG + Intronic
1074495842 10:113979461-113979483 TTCTGGGTTATCAGGCCTGAGGG - Intergenic
1074620592 10:115116068-115116090 TTTAGGCTTTGTTGGCCAGATGG + Intronic
1074936576 10:118187926-118187948 GTTTGGCTTTGCTGGCCATACGG - Intergenic
1075330125 10:121567839-121567861 TGTAGGGCTTGCAGGCCACAGGG - Intronic
1075339311 10:121632903-121632925 CAGTGGGTTTGCAGGCCAGGAGG + Intergenic
1075953163 10:126499321-126499343 GTTTGGCTTTGCGGGCCATATGG - Intronic
1076002127 10:126920679-126920701 TTTAGGTTTTGCAGGCCAAGAGG + Intronic
1076063686 10:127431798-127431820 TTTTAGGCTTGCAGGACATATGG - Intronic
1076996806 11:301209-301231 TTTTGTATTTGCAGTCGAGACGG + Intergenic
1078498996 11:11850715-11850737 TTTTGTTTTTGCAGCCCAAATGG - Intronic
1078584441 11:12569881-12569903 TTTTGGCTTTGCAGGCCATATGG - Intergenic
1078855544 11:15204012-15204034 TTTTGGCTTTGAAGGCTATATGG - Intronic
1079295189 11:19226686-19226708 TTTTGGGTTTTAAGGCCATATGG - Intronic
1079349118 11:19677862-19677884 TTTAGGCTTTGCAGGCCATATGG - Intronic
1080330265 11:31129441-31129463 TTTTGGCTTTGTAGGCCATAAGG + Intronic
1080341459 11:31270388-31270410 TTTTGGTTTTGCAAGCCAGAAGG - Intronic
1080685065 11:34508609-34508631 TTTAGGATTAGCAGGCCAAAAGG - Intronic
1080826634 11:35854084-35854106 TTTAGGCTTTGCAGACCATATGG + Intergenic
1081358127 11:42139105-42139127 TTTATGCTTTGCAGGCCATATGG + Intergenic
1081490227 11:43562329-43562351 TTTAGGCTTTGCAGCCAAGAAGG + Intronic
1082089649 11:48078906-48078928 TTTAGTCTTTGCAGGCCATATGG - Intronic
1085087010 11:73675193-73675215 TTTTGGGTTTTAGGGCCATAAGG + Intergenic
1085218722 11:74854419-74854441 TTTAGGCTTTGCAGACCATATGG + Intronic
1085232224 11:74982227-74982249 TTTTGGGGGTGTAGGCCATAAGG - Intergenic
1085305003 11:75480971-75480993 TTTAGGCTTTGCAAGCCATATGG - Intronic
1085982470 11:81741700-81741722 TTTAGATTTTGCAGGCCATAAGG - Intergenic
1086979689 11:93179867-93179889 TTTCTGCTTTGCAGGCCATATGG - Intronic
1087949172 11:104199074-104199096 TTTTAGGTTTGTAGCCCATATGG + Intergenic
1088744853 11:112796768-112796790 TTTAGGCTTTGCAGGCCACGCGG - Intergenic
1088777887 11:113103730-113103752 TTTTGTCTTTGCAGGCCATATGG + Intronic
1089257713 11:117202716-117202738 TTTAGGCTTTGCAGGACACATGG - Exonic
1091218342 11:133917124-133917146 TTCTGGCTTTCCAGGCGAGAAGG - Intronic
1091295231 11:134469049-134469071 TTCTTGCTTTGCAGGCCATACGG - Intergenic
1091916743 12:4275340-4275362 TTTGGGGTTTTCACGCCAAAAGG + Intronic
1092064540 12:5578875-5578897 TTTTGGATTTGCAGGCCATATGG + Intronic
1092392234 12:8090958-8090980 TTTAGGTTTTGCAGGTCAGGTGG + Intronic
1094032660 12:26030829-26030851 TTTAGGCTTTGCAGGCAATATGG + Intronic
1094045911 12:26166762-26166784 TTTTGGCTTTGCAGGCTATATGG - Intronic
1094399899 12:30051208-30051230 TTTAGGCTTTGCAGGCCACATGG + Intergenic
1094668498 12:32545472-32545494 TTTAGGCTTTGCAGGCCATATGG + Intronic
1095415280 12:41969820-41969842 TTTAGGCTTTGTAGGCCACAAGG + Intergenic
1095415519 12:41972805-41972827 TTTTGGTTTTGTGGGCCATATGG + Intergenic
1095661276 12:44740016-44740038 TTTTGGTCTTGCATGCCACATGG - Intronic
1097361072 12:58658458-58658480 TTTTGGCTTTGTGGGCCATATGG + Intronic
1098297845 12:69022357-69022379 TTTAGGATCTGCAGGCTAGATGG - Intergenic
1098377353 12:69831334-69831356 TTTAGGTTTTGCAGGCCACATGG - Intronic
1099171895 12:79374928-79374950 TTTAGGCTTTGCAGGCCACATGG + Intronic
1099594175 12:84637156-84637178 TTTAGGCTTTGCAGGCCATGAGG - Intergenic
1100001622 12:89843738-89843760 TTTGGGGTGTGCCAGCCAGAAGG - Intergenic
1100599989 12:96104790-96104812 TTTTGGCTTTGTGGGCCATATGG + Intergenic
1100623069 12:96299559-96299581 TTTTGTGTTTTCAGTACAGACGG + Intronic
1100761976 12:97817726-97817748 TTTAGGCTTTGCAGGCAATAGGG + Intergenic
1100893011 12:99147028-99147050 TTTAGGCTTTGCAAGCCACATGG - Intronic
1100924571 12:99530024-99530046 TTTAGGCTTTGCAGGCCACATGG + Intronic
1100997006 12:100312302-100312324 TTTTGGGATTGAAGGCGTGATGG + Intronic
1101022830 12:100571360-100571382 TTTTAGGTTTTAAGACCAGAAGG + Intergenic
1101347200 12:103896970-103896992 TTATGGGATTTCAGGTCAGAAGG - Intergenic
1102563898 12:113782084-113782106 TTTCCGTTTTGCAGGCCAGATGG - Intergenic
1102568576 12:113813276-113813298 TTTAGGCTTTGCAGGTCATAAGG + Intergenic
1102828692 12:115974214-115974236 TTTCAGCTTTGCAGGCCAGATGG - Intronic
1102966813 12:117134178-117134200 TTTGGGCTTTGCGGGCCATATGG - Intergenic
1102988180 12:117295466-117295488 TTTTGGCTTTGTGGGCCACATGG - Intronic
1103181805 12:118919040-118919062 TTTAGGCTTTGCAAGCCATATGG - Intergenic
1103184359 12:118943596-118943618 TTTTGGCTTTATGGGCCAGATGG + Intergenic
1103283629 12:119781956-119781978 TTTCAGCTTTGCAGGCCACATGG + Intronic
1103449583 12:121019079-121019101 TTTTGTTTTAGCAGCCCAGATGG + Intergenic
1103698887 12:122837487-122837509 TTTTGTGTTTGCAGTAGAGAAGG + Intronic
1103849557 12:123923324-123923346 TTTTGGCTTTGGAAGCTAGATGG - Intronic
1103860744 12:124011374-124011396 TCTTGGATTTGCAGGTCTGAAGG - Exonic
1104307816 12:127625306-127625328 TTTTTGGTTTACAGGCTAAAAGG + Intergenic
1104426903 12:128685355-128685377 TTATGGGTTTGCAGGTAAGCGGG + Intronic
1106141902 13:27018866-27018888 TTTAGGCTTTGCGGGCCATACGG - Intergenic
1106283541 13:28298648-28298670 TTTTGGGTTGGCTGTCTAGAAGG + Intergenic
1106827900 13:33543860-33543882 TTTTGCTGTTGCAGGACAGACGG + Intergenic
1107001417 13:35549988-35550010 TTTAGGCTTTGCAGGCTATATGG - Intronic
1107298919 13:38945613-38945635 TTTTGGCTCTGGAGGACAGATGG - Intergenic
1107298935 13:38945706-38945728 TTTTGGCTCTGGAGGACAGATGG - Intergenic
1107570408 13:41651505-41651527 TTTAGGCTTTACAGGCCATATGG + Intronic
1107834270 13:44400977-44400999 TTTAGGCTTTGCAGGCCATATGG + Intergenic
1108289160 13:48940708-48940730 TCTAGGCTTTGCAGGCCATATGG - Intergenic
1109030873 13:57185320-57185342 TTTAGGGTTTGCAGGTCATATGG + Intergenic
1109590392 13:64472854-64472876 TTTAGGCTTTGCAGGACATAGGG - Intergenic
1110596413 13:77325914-77325936 TTTTGGATAAGCAGGCCCGAGGG - Intronic
1110784558 13:79508744-79508766 TTTTGGGAATGCAGCCCAGTAGG + Intronic
1111209617 13:85060697-85060719 TTTAGGGTTTGAAGGCCATATGG - Intergenic
1111505390 13:89183204-89183226 TTTTGGTTTTGCAGGCTCGTAGG - Intergenic
1111763662 13:92498618-92498640 TTCCTGGTTTGCAGGGCAGAGGG + Intronic
1111912869 13:94331314-94331336 TTTAGGCTTTGCAGACCATAGGG - Intronic
1112570930 13:100592461-100592483 TTTAGGCTTTACAGGCCATATGG - Intergenic
1112798001 13:103078381-103078403 TTTTGGTTTTGCAGGACGGAAGG + Intergenic
1113056681 13:106275601-106275623 TTCTGGGTTAGGAGGCAAGAAGG - Intergenic
1113140239 13:107139655-107139677 TTTAGGTTTTGCAGGCCATGTGG + Intergenic
1114563218 14:23608443-23608465 TTTAAGCTTTGCAGGCCATATGG - Intergenic
1115277178 14:31621736-31621758 TTTAGGATTTGCTGGCAAGACGG - Intronic
1115389180 14:32835110-32835132 TTTAGGTTTTGCAGGCCATATGG - Exonic
1115730038 14:36258789-36258811 CTTAGGCTTTGCAGGCCATATGG - Intergenic
1117197138 14:53352089-53352111 TTTAGGCTTTGCAGGCCAATAGG - Intergenic
1117754963 14:58965163-58965185 TTTAGGCTTTGGAGGCCACAAGG - Intergenic
1117882095 14:60322088-60322110 TTTAGGCTTTGCAGGCTATATGG + Intergenic
1118535451 14:66758518-66758540 TTTTGAGTTTGATGGCCTGAAGG + Intronic
1118709771 14:68509735-68509757 TTTTGGCCTTGCAGGCCACAGGG + Intronic
1118860703 14:69660887-69660909 TTTAGGCTTTTCAGGCCACATGG - Intronic
1118873494 14:69763417-69763439 TTTTAGGCTTTCAGGCCATATGG + Intronic
1119165949 14:72492917-72492939 TTTAGGCTTTGTGGGCCAGATGG - Intronic
1119204846 14:72786548-72786570 TTTAGGCTTTGCAGGCCACATGG - Intronic
1119672822 14:76532456-76532478 CTTTCGGTTTGCATGCCATAGGG + Intergenic
1120729282 14:87983944-87983966 TTTTGGGTTTGTGGGCCAAAAGG - Intronic
1121110054 14:91306619-91306641 TTTTGGGTTTGCCAGCCATGGGG + Intronic
1121183232 14:91945322-91945344 TTGTGGGTGTGGATGCCAGATGG + Intronic
1124076239 15:26447337-26447359 TTTTGGCTTTGCAGGCCATATGG - Intergenic
1124406913 15:29401098-29401120 CTCTGGGTTTGCAGGTCAGCTGG - Intronic
1124577168 15:30920027-30920049 TTTAGGCTTTGCAGGCCATATGG + Intronic
1125284666 15:38079487-38079509 TTTAGGCTTTGCAGGCCATATGG - Intergenic
1125894299 15:43289032-43289054 TTTAGCCTTTGCAGGCCATAAGG + Intronic
1126419044 15:48452134-48452156 TTTGGGGTATGCAGCCAAGATGG + Intronic
1126468950 15:48986343-48986365 TTCAGGCTTTGCAGGCCATATGG + Intergenic
1126843724 15:52740665-52740687 TGTGGGGTTTGAGGGCCAGAAGG - Intergenic
1126862023 15:52894413-52894435 CTTTGGGTTTGCAGGGTATAGGG - Intergenic
1127317985 15:57815544-57815566 TATTGGGTTTGCTGGCAAGATGG - Intergenic
1127652954 15:61026994-61027016 TTTTTTTTTTGCAGGCCAGGAGG - Intronic
1127941452 15:63701479-63701501 TTTAGGCTTTGCAGACCATAAGG + Intronic
1127987239 15:64083329-64083351 CTTAGGGTTTGGAGGTCAGAAGG - Intronic
1128047718 15:64633677-64633699 TTTGGGCCTTGCAGGCCACATGG - Intronic
1128649708 15:69401548-69401570 TTTTGGGGTTGCAGGAAAAATGG + Intronic
1129915068 15:79261941-79261963 TTTAGGCTTTGCAGAGCAGATGG + Intergenic
1129979135 15:79850419-79850441 TTTAGGCTTTGCAGGCCTTAGGG + Intronic
1130434153 15:83880483-83880505 TTTTAGGTTTTCAGGCTACATGG - Intronic
1130573999 15:85074340-85074362 TTTAGGCTTTGCAGGCCATATGG - Intronic
1130843274 15:87721810-87721832 TTTCAGCTTTGTAGGCCAGAAGG - Intergenic
1130898158 15:88186780-88186802 TTCAGGTTTTGCAGGCCATATGG - Intronic
1130918839 15:88327210-88327232 TTTAGGCTTCGCAGGCCATATGG - Intergenic
1131343616 15:91626415-91626437 TTTTTGGTTAGGAAGCCAGAGGG - Intergenic
1132236560 15:100226382-100226404 ATTTGGGGTTTCAGGCCTGAAGG - Intronic
1132294337 15:100724494-100724516 TTTAGGCTTTGCAGGCCATACGG + Intergenic
1132323439 15:100944631-100944653 TTTTGTGTTTGGAAGGCAGATGG + Intronic
1133214068 16:4280213-4280235 TTTAGGCTTTGCAGACCACACGG + Intergenic
1133458710 16:5967144-5967166 TTGTGGCTTTGCGGGCCAGATGG - Intergenic
1133583386 16:7167821-7167843 TTTAGGCTTTGCAGGCCAGATGG - Intronic
1133678117 16:8095123-8095145 TTTTGGGGTTTCAGGCCTGGTGG - Intergenic
1133753875 16:8746645-8746667 TGTTGGGATTACAGGCGAGATGG + Intronic
1133770530 16:8864978-8865000 TGGTGGGTTTTCAGGCCAGGAGG - Intronic
1134055031 16:11164645-11164667 TTTAGGCTTTGCAGGCCATGTGG + Intronic
1134196391 16:12162435-12162457 TTTTGGCTTTGCAGGCCATATGG + Intronic
1134204992 16:12229960-12229982 TTTTGGCTTTGTTGTCCAGATGG + Intronic
1134253379 16:12590849-12590871 TTTTGTGTTTTCAGGAGAGAAGG - Intergenic
1134387703 16:13789367-13789389 TTTTAGTTTTGCAGGTCACAGGG - Intergenic
1134421624 16:14096837-14096859 TTTGGTGTTTGCAAGCCAGAAGG + Intronic
1134590618 16:15450087-15450109 TTTAGGGTGTGCAGGTCATATGG + Intronic
1134633601 16:15775555-15775577 TTCAGGCTTTGCAGGCCAGGTGG - Intronic
1135622057 16:23964419-23964441 TTTAGGTTTTGCAGGCCACATGG - Intronic
1135723540 16:24836925-24836947 TTTAGGCTTTGCAGGCCATGTGG + Intergenic
1135760643 16:25135490-25135512 TTTAGCCTTTGCAGGCCAGATGG - Intronic
1137361147 16:47816605-47816627 TTTAGGCTTTGCAGGCCATATGG + Intergenic
1137527932 16:49253104-49253126 TTTTGGCTTTGCAGGCCATATGG + Intergenic
1137620692 16:49874716-49874738 TTTTGGCTTTTCAGGCCATAAGG + Intergenic
1138169210 16:54833188-54833210 TTTAGGCTTTGCAGGCTATATGG - Intergenic
1138187194 16:54985834-54985856 TTTGGGCTTTGCATGCTAGACGG + Intergenic
1138255800 16:55558656-55558678 TTTTGACTTTGCAGACCACATGG + Intronic
1138493411 16:57391732-57391754 TTTTGTGTTTGTAGTACAGATGG - Intergenic
1138838263 16:60464884-60464906 TTTAGGCTTTGTAGGCCATATGG + Intergenic
1138915853 16:61463393-61463415 TTTTGGCTTTGCCAGCCAGTGGG + Intergenic
1139685248 16:68598386-68598408 TTTGGGCTTTGCAGGACATATGG - Intergenic
1140761541 16:78113348-78113370 TTTAGGATTTGCAGGGCATATGG + Intronic
1140980675 16:80105863-80105885 TTTAGGCTTTGCAGGCCAAATGG + Intergenic
1141017342 16:80462990-80463012 TTTACGCTTTGCAGGCCAGAGGG + Intergenic
1141044710 16:80705685-80705707 TTTAGGCTTTGAAGGCCACATGG + Intronic
1141063081 16:80892832-80892854 TTTCGGCTTTGAGGGCCAGATGG + Intergenic
1141203971 16:81919017-81919039 TTTAGGTTTTGCAGGCCATATGG + Intronic
1141308204 16:82887220-82887242 TTTCAGCTTTGCAGGCCAGCTGG + Intronic
1143294093 17:5857605-5857627 TTCAGGCTTTGCAGGCCATATGG - Intronic
1143298228 17:5887423-5887445 TTTAGGCTTTGGAGGCCATATGG - Intronic
1144436359 17:15246226-15246248 TTTAGGCTTTGCAGGTCATACGG + Intronic
1144657893 17:17049673-17049695 TTTAGGTTTTGCAGGCCAACAGG + Intronic
1144825217 17:18101962-18101984 TGTTGGGTTTTCGGGCCAGGCGG - Exonic
1145275735 17:21429037-21429059 TTTAGGCTTTGTAGGCCATATGG - Intergenic
1145324759 17:21795671-21795693 TTTTGGGTTTTTAGGAGAGATGG + Intergenic
1145712026 17:26986922-26986944 TTTAGGCTTTGTAGGCCATATGG - Intergenic
1146172477 17:30644645-30644667 TTTTGGCTTCGCAGGCTACAGGG + Intergenic
1146251798 17:31352666-31352688 TTTTGCCTTTGCTGGCCAGCAGG + Intronic
1146345931 17:32060654-32060676 TTTTGGCTTCGCAGGCTACAGGG + Intergenic
1146570555 17:33948908-33948930 TTTTAGGTATGCAGGCCAAAGGG + Intronic
1147045701 17:37750408-37750430 TTTAGGTTTTGTGGGCCAGATGG + Intergenic
1147351189 17:39845640-39845662 TTTAGGCTTTGCAGGTCATATGG - Intronic
1147639861 17:41989933-41989955 TTTAGCCTTTGCAGGCCACAGGG - Intronic
1147893247 17:43732488-43732510 TTGAGGCTTTGCAGGCCATAAGG - Intergenic
1148176760 17:45572779-45572801 TTTAGGTTTTGCAGGCCACCTGG - Intergenic
1148294616 17:46490168-46490190 TTTAGGTTTTGCAGGCCACCTGG + Intergenic
1149296325 17:55265269-55265291 TTTCGGGTTTCCAGTGCAGACGG - Exonic
1149753016 17:59164210-59164232 TTCAGGTTTTGCAGGCCATATGG - Intronic
1150169175 17:62973992-62974014 TTTAGGCTTTGCAGGCCGTATGG - Intergenic
1150192739 17:63260315-63260337 TTTAGGCTTTGCAGGCCACATGG + Intronic
1150473161 17:65454605-65454627 TCTTTGCTTTGCAGGCCATAAGG - Intergenic
1150697055 17:67414647-67414669 TTTTGGCTTTGCACACCATATGG - Intronic
1150866305 17:68853858-68853880 TTTTTGCTTTGGAGGTCAGATGG + Intergenic
1151023967 17:70655720-70655742 TTTTGGCTTTGCAGGCCATATGG + Intergenic
1151047348 17:70936782-70936804 TTTTGGCTTTTTTGGCCAGAGGG - Intergenic
1153141297 18:1975333-1975355 TTTAGGCTTTGCAGGCCACATGG + Intergenic
1153197563 18:2617429-2617451 TTCTGGCTTTGCAGGCCACATGG - Intergenic
1153510093 18:5842575-5842597 ATTAGGTTTTGCAGGCCATATGG - Intergenic
1153884866 18:9455581-9455603 TTTAGGTTTTGCAGTCCATATGG - Intergenic
1155017077 18:21854270-21854292 TTTTGGCTTTGTAGGCCACATGG + Intronic
1155237266 18:23833166-23833188 TTTTGGTTTTGCAGGCCCTGTGG + Intronic
1155258572 18:24019812-24019834 TTTAGGCTTTGCATGCCATATGG - Intronic
1155348701 18:24884593-24884615 TTTAGGGTTTGTAAGGCAGAGGG + Intergenic
1156641074 18:39099407-39099429 TTTAGGTTTTGACGGCCAGATGG + Intergenic
1157005761 18:43582052-43582074 TTTGGGCTTTGCAGGCCATATGG + Intergenic
1157233147 18:45938288-45938310 TTTTGGGTTTGTAGTAGAGACGG - Intronic
1157319331 18:46622196-46622218 TTTAGGATTTGCAGGCCATTTGG + Intronic
1157568122 18:48693852-48693874 TTTAGGCTTTGCAGGCCATAAGG - Intronic
1157574039 18:48731857-48731879 TTCAGGTTTTGCAGGCCATAGGG + Intronic
1157782395 18:50451202-50451224 TTTAGGCTTTGCAGGCCATATGG + Intergenic
1158361943 18:56684362-56684384 TTTAGGCTCTGCAGGCCATATGG + Intronic
1159548112 18:69866371-69866393 TTCTGGGTTTGCAGATAAGAGGG - Intronic
1159772333 18:72560597-72560619 TTTAGGCTTTGCAGGCCATGCGG - Intronic
1160012823 18:75119476-75119498 TTTAGGCTTTTCAGGCCAGAGGG + Intergenic
1160275746 18:77433285-77433307 TTTTGGGTTTGCAGGCCAGATGG - Intergenic
1160944470 19:1634906-1634928 TGTTGGCTGTGCAGGACAGATGG - Intronic
1161084052 19:2325818-2325840 CTTTAGCTTTGCAGCCCAGATGG - Intronic
1161235255 19:3194571-3194593 TTTCGGCTTTGCAGGCTGGATGG - Intronic
1161330695 19:3685836-3685858 TTTAGGGTTTGTGGTCCAGATGG - Intronic
1161597034 19:5155874-5155896 ATTGGGCTTTGCAGGCCAGGTGG - Intergenic
1161634764 19:5380829-5380851 TTTTTATTTTGCAGGCCATATGG - Intergenic
1161730590 19:5958363-5958385 TTTAAAGTTTACAGGCCAGAGGG + Intronic
1161882010 19:6962050-6962072 GTTTGGCTTTGCTGGCCACAAGG - Intergenic
1161920649 19:7263105-7263127 TTTTGTATTTTCAGGACAGAGGG - Intronic
1162839741 19:13347624-13347646 TTTAGGCTTTGTGGGCCAGATGG - Intronic
1162998334 19:14350498-14350520 TTTGGGGTTGTCAGGCCACATGG - Intergenic
1163345383 19:16738178-16738200 TTTTGGCTTTACAGGCCAGATGG - Intronic
1164811610 19:31161791-31161813 TTTTGGCTCTGCAGGCCACACGG + Intergenic
1165201494 19:34148562-34148584 TTTAGGATTTGCAGGCCAAGTGG + Intergenic
1165451360 19:35885594-35885616 TTGTGGATTTCCAGGCCAGTTGG + Intergenic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1167991566 19:53365505-53365527 TTTGGGTTTTGGAGGCGAGATGG - Intergenic
1168432210 19:56290376-56290398 TGTAGGCTTTGCAGGCCACATGG - Intronic
1168460843 19:56556354-56556376 TTTGGGCTCTGCAGGCCACATGG - Exonic
1168688242 19:58361525-58361547 TTTTGTGTTTTCAGTACAGATGG + Intronic
926431611 2:12792680-12792702 TTTTAGGCTTTCAGGCCATAAGG - Intergenic
926440106 2:12879546-12879568 TTTTAGGCTTTCAGGCCATAAGG + Intergenic
926748013 2:16175638-16175660 TCTAGGTTTGGCAGGCCAGAGGG + Intergenic
926807595 2:16725497-16725519 TTTAGGATTTGAAGGGCAGAAGG - Intergenic
926808946 2:16739401-16739423 TTTTTGAGTTGCAGCCCAGATGG - Intergenic
927364632 2:22279796-22279818 TTCTGGCTTTGCAGGCCATATGG - Intergenic
927730572 2:25467815-25467837 TTTAGGCTTTGTAGGCCATAAGG + Intronic
927831961 2:26359151-26359173 TTGAGGCTTTGCAGGCCATATGG - Intronic
928355014 2:30604407-30604429 TTTAGGCTGTGCAGGCCATATGG + Intronic
928512908 2:32018106-32018128 TTTTGTTATAGCAGGCCAGAAGG + Intronic
929260102 2:39857029-39857051 TTTTGGCTTTGCAGGCCATATGG + Intergenic
929548548 2:42874309-42874331 ATTTGGGATTGCAGCCCAGTAGG + Intergenic
929980098 2:46670175-46670197 TTTTGGTTTGGCTGGACAGATGG - Intergenic
931029271 2:58153940-58153962 TTTAGGTTTTGCAGGTCATATGG + Intronic
931652147 2:64478191-64478213 TTTCGGCTTTGCAGGCCACATGG - Intergenic
931807812 2:65824899-65824921 TTTTGTGTTTGCTGGCCAAGTGG + Intergenic
931897426 2:66747862-66747884 TTCTGCTTTTGCAGGCCATAAGG - Intergenic
932076821 2:68672103-68672125 TCTTGGGAATGCAGGCCAGTAGG + Intergenic
932091773 2:68812108-68812130 TTTAGGCTTTGCAGGCCAGATGG + Intronic
932247658 2:70209112-70209134 TTTTGTGTTTTCAGTACAGATGG - Intronic
933259254 2:80113649-80113671 TTTTTGGCTTACATGCCAGATGG - Intronic
933633963 2:84686829-84686851 TTTAGGCTTTGCAGGTCATATGG - Intronic
933750502 2:85599860-85599882 TTTAAGGTTTGCAGGGGAGAAGG + Intronic
934064723 2:88330331-88330353 TTCTCAGATTGCAGGCCAGAAGG - Intergenic
934648798 2:96075478-96075500 TATAGGCTTTGCAGGCCATATGG + Intergenic
934726823 2:96626861-96626883 TTTAGGGTTTCCAGGCCATATGG + Intronic
935178941 2:100673447-100673469 TTCAGGCTTTGCAGGCCATACGG + Intergenic
935530908 2:104231456-104231478 TTTAGGCTTTGAAGGCCATAAGG + Intergenic
936392129 2:112084926-112084948 TTTTGGCTTTGCAGGCCATATGG + Intronic
937114430 2:119394635-119394657 TTTTGGCTTTACAGGCCATGTGG - Intergenic
937636333 2:124159327-124159349 TTCTGGCTTTGCAAGCCATATGG + Intronic
938832402 2:135065619-135065641 TTTTGTGTTTTCATGTCAGATGG + Intronic
938998447 2:136705717-136705739 TTTTGGGGTGGCAGGCAGGAAGG - Intergenic
939186846 2:138871215-138871237 TTTAGGTTTTGCAGGTCATATGG + Intergenic
939191235 2:138918726-138918748 TTTAGGCTTTGTAGGCCATAAGG + Intergenic
939246457 2:139630714-139630736 TTTTGATTTTGGAGCCCAGAGGG + Intergenic
939437627 2:142199244-142199266 TTTAGACTTTGCAGGCCACAAGG + Intergenic
940561492 2:155302558-155302580 TTTTACCTTTGCAGGCCATATGG + Intergenic
940677729 2:156745729-156745751 TTCAGGCTTTGCAGGCCATACGG + Intergenic
940753809 2:157658987-157659009 TTTTGGTTTTGTAGGCCACAGGG + Intergenic
940769230 2:157822802-157822824 TTTCGGTTTTGCAAGCCATACGG - Intronic
940975080 2:159933864-159933886 TTTAGGCTTTGCAGGCCATTCGG + Intronic
941384327 2:164834653-164834675 TTTTAGCTTTGCAGGCCATATGG + Intronic
941462085 2:165783587-165783609 TTTTTGCTTTGCTGGCCATATGG + Intronic
941517309 2:166494921-166494943 GTTTGGGAGTGAAGGCCAGAGGG + Intergenic
941736426 2:168981756-168981778 TTTAGGCTTTTCAGGCCATATGG + Intronic
941900139 2:170670228-170670250 TTTAGGCTTTGTAGGCCATAAGG - Intergenic
943374399 2:187057079-187057101 TTTTTGGTTTGGGGGCCATATGG - Intergenic
943859605 2:192844061-192844083 TTTTAGCTTTGCTGGCCATATGG + Intergenic
943886724 2:193227929-193227951 TTTAGGATTTGTATGCCAGACGG - Intergenic
944143452 2:196481558-196481580 TTTTGAGCTTGCAAGCCTGAGGG - Intronic
944682176 2:202087171-202087193 TTTAGGCTTTGCAGGCCATATGG - Intronic
944796746 2:203194620-203194642 TTTGTGCTTTGCAGGCCAAAAGG + Intronic
945824659 2:214706631-214706653 TATTGGTTCTGCAGGGCAGATGG - Intergenic
946290312 2:218739453-218739475 ATTTTTGTTTGCAGGCCAGTCGG - Intronic
946422559 2:219572695-219572717 GCATGGGTTTGCAGGCCAGGCGG + Intronic
947368415 2:229420207-229420229 TTTAGGCTTTGCAGGCCATATGG - Intronic
947693692 2:232164026-232164048 TTTTGGCTTTGCAGGCCATATGG - Intronic
948932035 2:241137954-241137976 TTTGGGATGTGCTGGCCAGAAGG + Exonic
1168998856 20:2152151-2152173 TTTAGGCTTTGCATGCCATAGGG + Intronic
1169053623 20:2601331-2601353 TTTTTGGTTTGCTGGTCATATGG - Intronic
1169109787 20:3024920-3024942 TTTAGGCTTTGCAGCCCACATGG + Intronic
1169154406 20:3317159-3317181 TGTTGGGATTGCAGGCAACATGG + Intronic
1169210315 20:3762763-3762785 TTTAGACTTTGCAGGCCATATGG - Intronic
1169309692 20:4525028-4525050 TTTTAGGTTTGTAGGCCATATGG - Intergenic
1169963764 20:11192313-11192335 TTTTGACTTTGCAGGGCATATGG - Intergenic
1170086232 20:12535432-12535454 CTTTAGGATTGCAGGCCACATGG + Intergenic
1170136717 20:13082615-13082637 TTTGGGCTTTGCAGGCCATATGG - Intronic
1170415179 20:16132198-16132220 TGTAGGCTTTGCAGGCCATATGG - Intergenic
1170540753 20:17385146-17385168 TTTAGGCTTTGCAGGCCATATGG - Intronic
1170877558 20:20264907-20264929 TTTAGACTTTGCAGGCCATATGG + Intronic
1170935483 20:20805663-20805685 TTGTGGGTATGCAGGCAATAGGG + Intergenic
1171040924 20:21762934-21762956 TTTAGGCTTTGCAGGCCATTTGG - Intergenic
1171097629 20:22347034-22347056 TTTTGGGTTGTCTGTCCAGAGGG - Intergenic
1171134279 20:22683153-22683175 TTTAGGCTCTGCAGGCCATATGG - Intergenic
1171177461 20:23063301-23063323 TTTAGGTTTTGCAGGCCACTTGG + Intergenic
1171358771 20:24571907-24571929 TTTTGGGTTGAAAGGCCTGAAGG - Intronic
1172389045 20:34553753-34553775 TTTAGGCTTTGCAGGCCATGTGG - Intronic
1173159610 20:40642685-40642707 GTTAGGCTTTGCAGGCCATAGGG + Intergenic
1173273857 20:41561066-41561088 TTTAGGCTTTGTAGGCCATATGG + Intronic
1173447094 20:43129001-43129023 TTATAGCTTTGTAGGCCAGATGG - Intronic
1173565684 20:44036757-44036779 TTTAGGCTTTGTGGGCCAGATGG - Intronic
1173573794 20:44096851-44096873 TTTAGGCTTTGCGGGCCACATGG + Intergenic
1173900738 20:46586841-46586863 TTTTGGCTTTGCAGGCCACATGG + Intronic
1173980195 20:47218089-47218111 TTTAGGTTTTGCAGGCCGCATGG - Intronic
1173991115 20:47304346-47304368 TTGAGGCTTTGCAGGCCATAAGG + Intronic
1174041956 20:47706404-47706426 TTTAGGCTTTGTGGGCCAGAGGG + Intronic
1174283501 20:49456053-49456075 TTTGAGGTTTGCAGGCCAAGAGG - Intronic
1174784109 20:53416628-53416650 TTTTGGATCTGCAGGCCATAGGG - Intronic
1174820336 20:53721366-53721388 TTTAGGCTTTGGAGGCCAGATGG + Intergenic
1174915579 20:54649827-54649849 TTTAGGTTTTGCAGACCATATGG - Intronic
1174994252 20:55547671-55547693 TTTTGGTTGTGTAGGCCATAAGG - Intergenic
1175058809 20:56222497-56222519 TCTTGGGTTTGGAGGCTGGAAGG + Intergenic
1175151477 20:56938315-56938337 TTCAGGCTTTGCAGGTCAGAAGG - Intergenic
1175348912 20:58303837-58303859 TTTAGGGCTTGCTGGCTAGAAGG - Intergenic
1175642211 20:60640257-60640279 TTTGGCTTTTGCAGGCCACATGG + Intergenic
1177173641 21:17680654-17680676 TTCTGGTTTTGCAGGCCATCTGG + Intergenic
1177865864 21:26512768-26512790 TTTAGGCTTTGCAGGCCACGTGG - Intronic
1178636746 21:34310235-34310257 TTTTAGCTTTGCAGGTCATACGG + Intergenic
1179082921 21:38190093-38190115 CTTTGGCTTTGCGGGCCATATGG - Intronic
1179184879 21:39077856-39077878 TTTAGGCTTTGCAAGCCAGGTGG + Intergenic
1179493767 21:41758760-41758782 TTTAGGCTTTGCAGGCCGCAGGG - Intronic
1179987453 21:44929549-44929571 TTTAGGCTTTGCTGGCCAAATGG + Intronic
1181016546 22:20072682-20072704 TTTAGCGGTTCCAGGCCAGAAGG + Intergenic
1181939888 22:26467277-26467299 TTTTGGCTTTGCAGGGCATATGG + Intronic
1181978896 22:26752327-26752349 TTTTGGGCTTGCATGACACAGGG - Intergenic
1182040567 22:27236113-27236135 TTTCAGCTTTTCAGGCCAGAGGG - Intergenic
1182512187 22:30827367-30827389 TGTTAGGTTTGCATGGCAGAAGG - Intronic
1182637134 22:31737063-31737085 TTTAGGCTTTGCAGGTCATATGG - Intronic
1182930881 22:34173335-34173357 TTGTGGTCTTGCAGGCCATATGG + Intergenic
1183017487 22:35001192-35001214 TTTAGGTTTTGCAGGCCACATGG - Intergenic
1183280872 22:36931740-36931762 TTGTGGGTCTGCCGGCCAGGTGG + Intronic
1183484920 22:38083624-38083646 TTTGAGGTTTGGAGGGCAGAAGG - Intronic
1183668179 22:39257002-39257024 TCTTGGCTCTGCCGGCCAGAGGG + Intergenic
1183810929 22:40256678-40256700 TTTAGGGTTTACTGGCCATATGG - Intronic
1184624238 22:45710765-45710787 TTTAAGCTTTGCAGGCCAAATGG - Intronic
1184945664 22:47802080-47802102 AATTGTGTCTGCAGGCCAGAGGG - Intergenic
1184987292 22:48144522-48144544 TTGTGGGGTCGCCGGCCAGATGG + Intergenic
1185176711 22:49331713-49331735 TTTTGTGTTTTTAGGCCATATGG + Intergenic
949134325 3:544451-544473 TATTGGGTCTGCAGGTCAGCTGG - Intergenic
949196121 3:1310436-1310458 TCTTGGGTATGCAGGACTGATGG - Intronic
951304658 3:21043590-21043612 TTTTGGGACTGCAGCCCAGTAGG + Intergenic
951403741 3:22268481-22268503 ATCTGGCTTTGCAGGTCAGAGGG + Intronic
951455295 3:22885377-22885399 TTTAGGCTTTGCAGGCCATGAGG + Intergenic
951476755 3:23114761-23114783 TTTTGGCTTTGCTGGCCATATGG - Intergenic
951682347 3:25307957-25307979 TTTAGGCTTTGCTGGCCATATGG - Intronic
951849949 3:27128094-27128116 TTTTGGCGTTCCAGGCCATATGG + Intronic
951958135 3:28281009-28281031 TTTAGGCTTTGTAGGCCATATGG - Intronic
952186488 3:30975211-30975233 TGTAGGCTTTGCAGGCCACACGG + Intergenic
952252452 3:31667676-31667698 TTTAGGCTTTGCAGGCCATATGG + Intronic
952506977 3:34016251-34016273 TTTAGGCTTTGCAGTCCATATGG + Intergenic
952835101 3:37595694-37595716 GTTTGGGTTTGTAGGCAGGATGG + Intronic
952841113 3:37646280-37646302 TTTTGGGCTTGTAGGCTATATGG - Intronic
952955090 3:38551864-38551886 TCTTGGGTTCTCAGGCCAGAGGG + Intronic
953221568 3:40976549-40976571 TTTAGGCTTTGCAGGCCACGTGG - Intergenic
953288143 3:41633456-41633478 TTTAGGTCTTGCAGGCCATATGG - Intronic
953336956 3:42101590-42101612 TTTTAGGTTTGCAGGTCAGAAGG + Intronic
953530609 3:43736574-43736596 TTTAGGCTTTGCAGGCCATATGG + Intergenic
953684409 3:45065182-45065204 TTTTGGGAATGCAGCCCAGTAGG + Intergenic
953984346 3:47429795-47429817 TTTAGGCTTTGCGGGCCAGACGG - Intronic
953993716 3:47503464-47503486 TTTTAGGCTTGCAGGTCATATGG + Intronic
954106712 3:48413529-48413551 TTTTCGCTTTGCAGGCCAAGTGG - Intronic
954271325 3:49511829-49511851 TTTAGGCTTTGCAGGCCATATGG + Intronic
955041437 3:55321213-55321235 TTTTGGCTTTGCAGGCCATCTGG - Intergenic
955065082 3:55526933-55526955 TGATGGGTCTGCAGGCCAGCAGG + Intronic
955511821 3:59688708-59688730 TTTAAGCCTTGCAGGCCAGATGG + Intergenic
955587590 3:60497978-60498000 TTTGGGCTTTGCAGGCCATATGG + Intronic
955732519 3:62001878-62001900 TTTAGGCTTTGCAGGCCAATTGG - Intronic
955747324 3:62153128-62153150 TTTAGGCTTTGCAGGCCAAGAGG - Intronic
955749457 3:62172972-62172994 TTTTGGCTTTGTTGGCCATATGG + Intronic
955751304 3:62187607-62187629 TTTCGGCTTTGCAGGCCACATGG - Intronic
955826623 3:62953919-62953941 TTTAGGCTTTGCATGCCATAAGG - Intergenic
955915551 3:63904463-63904485 TTTTGTGTTTTCAGGAGAGATGG + Intronic
955970973 3:64438194-64438216 TTTCAGTTTTGCAGGCCATAAGG + Intronic
956090587 3:65662370-65662392 TTTAGGCTTTGCAGACCATACGG + Intronic
956193873 3:66632826-66632848 ATTTGGCTTTGCAGGCCTGAGGG - Intergenic
956201560 3:66711600-66711622 TTTTGGCTCTGCAGGTCATATGG - Intergenic
956331669 3:68116931-68116953 TTTAGGTTTTGCAGGCCAGATGG - Intronic
956430680 3:69183118-69183140 TTTTGGCTTTGTGGGCCAGATGG + Intronic
956546096 3:70404977-70404999 TTTTGGTTTTGCTGGCCTCATGG - Intergenic
956856842 3:73283341-73283363 TTTTGGTTTTACAGGCCAAGGGG + Intergenic
956897437 3:73677818-73677840 TTTTGGCTTTTCAGGACATATGG - Intergenic
957002634 3:74903994-74904016 TTTTGGCTTTGCAGGCCAAATGG - Intergenic
957036729 3:75300398-75300420 TTTTTACTTTGCAGGCCAAATGG + Intergenic
957461065 3:80521078-80521100 TTTCTGGTTTTCAGGCTAGAAGG + Intergenic
958965179 3:100550859-100550881 TTTCTGGTTTTCAGGCCAGAGGG + Intronic
959579463 3:107968804-107968826 TTCAGGCTTTGCAGGCCATATGG + Intergenic
959668989 3:108953650-108953672 TGTAGTGTTTGCAGGCCGGATGG + Exonic
959680799 3:109094022-109094044 TTTAGGCTTTGCAGGCCATACGG + Intronic
959845408 3:111027190-111027212 TTTTAGCTTTGCAGGCCGTAAGG - Intergenic
960156629 3:114302929-114302951 TTTTGGGTTTGTAGGTCATATGG + Intronic
960453243 3:117836998-117837020 TTTGGGCTTTGCAGATCAGATGG - Intergenic
960790445 3:121424466-121424488 TTCTGGCTTTGCAGTCAAGAAGG - Exonic
961523539 3:127482432-127482454 TTTTGGCAGTGCAGGCCATATGG - Intergenic
961957923 3:130823391-130823413 TTTTAGGCTTGCAGGCCATATGG + Intergenic
962208687 3:133457783-133457805 TTTAGGCTTAGCAGGCCATATGG - Intronic
962541500 3:136387179-136387201 TTTAGGCTTTGCAGTCCATATGG + Intronic
963619337 3:147585880-147585902 TTTAGGTTTTGTAGGCCAGGAGG + Intergenic
965696396 3:171412873-171412895 TTTTTGTTATGCAGACCAGAGGG + Intronic
965968728 3:174528055-174528077 TTTTGGCTTTTCTGGCCACACGG - Intronic
965984194 3:174731921-174731943 TTTTAGGTTTGTGGGCCAAATGG + Intronic
966168776 3:177053198-177053220 TTTAGGCTCTGCAGGCCATAAGG + Intronic
966366422 3:179192635-179192657 TTTAGGCTTTGCAGGCCATATGG + Intronic
966836701 3:184054939-184054961 TGTTGGGTTGACAGGGCAGAGGG - Intronic
967277582 3:187791520-187791542 TTTTGGTTTTGCAGGACATAAGG + Intergenic
967340191 3:188388841-188388863 TTTAGGCTTTGTAGGCCAGATGG + Intronic
967459324 3:189726910-189726932 TTTTGACTTTGCAGGTCACATGG + Intronic
969332405 4:6484036-6484058 TTTTAGGCTTGTAGGCCATATGG - Intronic
969520738 4:7676377-7676399 TTTAGGCTTTGCAGGCCAAGAGG + Intronic
969909356 4:10429030-10429052 GTTTGGGTTTGAAGATCAGAAGG - Intergenic
970047208 4:11868286-11868308 TTTAAGCTTTTCAGGCCAGATGG - Intergenic
970159830 4:13177230-13177252 TTTTGCGTTTTCAGGCCAGCTGG - Intergenic
970801832 4:19981291-19981313 TTTTAGGTTTGGAGGCCATATGG + Intergenic
971016162 4:22491280-22491302 TTTGGGCTTTGCAGGCCAAGAGG + Intronic
971039620 4:22737224-22737246 TTGAGGCTTTGCAGGCCATATGG - Intergenic
971056981 4:22924335-22924357 TTTTGGCTTTGCAGGCAATATGG - Intergenic
971997762 4:33988553-33988575 TTTAGGCTTTGCAGACCACATGG - Intergenic
973318651 4:48787389-48787411 TTTTGGCTTTGCAGGCCATATGG + Intergenic
973975474 4:56258506-56258528 TTTTTGGTTTGCAGGCCTTGTGG + Intronic
974021999 4:56699873-56699895 TTTCGGTTTTGTAGGCCATATGG + Intergenic
975242770 4:72081299-72081321 TTTTGGGTTTGCAGGCCCGAAGG - Intronic
975328634 4:73088868-73088890 TTTAGGCTTTGCAGGTCACATGG + Intronic
975696881 4:77022465-77022487 TTTAGGTTCTGCAGGCCAAACGG + Intronic
975789774 4:77936654-77936676 TTTAGGTTTTGCAGGCCAAATGG - Intronic
975789934 4:77938236-77938258 TTTAGGCTTTGCAGGCCAAATGG - Intronic
976112344 4:81689491-81689513 TTAAGGCTTTGCAGGCCATATGG + Intronic
976186485 4:82447562-82447584 TTTAGGCTTTGCAGGCCCTATGG + Intronic
976627121 4:87197871-87197893 TTTTGGCTTTGTGGGCCATATGG + Intronic
976700298 4:87962760-87962782 TTTAGGCTTTGCAGGCCATATGG + Intergenic
977195625 4:94055484-94055506 TTATGGGTTTGAAGACCAGTTGG - Intergenic
977397550 4:96489657-96489679 GTTTGAGTTTGCAGGACAGCAGG - Intergenic
977441152 4:97070056-97070078 TTGTGGGTTTCCAGGCTTGAGGG - Intergenic
977663217 4:99615202-99615224 TTTACGCTTTGCAGGCCACATGG + Intronic
978945152 4:114486448-114486470 TTTAGGCTTTGCAGGCCATTTGG + Intergenic
980894537 4:138849524-138849546 TTTAGGCTTTGCAGGCCATATGG - Intergenic
981128376 4:141132493-141132515 TGTTGGGGTCGCAGGCCAGGCGG + Exonic
981311900 4:143305656-143305678 TTTAGGTTTTGCAAGCCATATGG - Intergenic
981687720 4:147473488-147473510 TTTTGGCTTTGAGGGCCATATGG - Intergenic
982127765 4:152199209-152199231 TTTAGGCTATGCAGGCCATATGG - Intergenic
983606557 4:169593226-169593248 TTTAGGTTTTGCAGGCCAGATGG + Intronic
983911462 4:173244195-173244217 GTTTGGCTTTGCAGACCACAGGG - Intronic
984031119 4:174605361-174605383 TTGTGGCTTTATAGGCCAGATGG + Intergenic
984274296 4:177590982-177591004 TTTTGTATTTGCAGTACAGATGG + Intergenic
984367285 4:178815685-178815707 TTTTGGCTTGGCATGCCATATGG + Intergenic
984916435 4:184729370-184729392 TTTAGGCTTTGCAGGCCGTAAGG + Intronic
985083317 4:186288467-186288489 CATTGTGTTTGCAGGACAGAGGG - Exonic
985599745 5:821081-821103 TTTTGATTTTTCAGGCCAGTTGG - Intronic
986448865 5:7847487-7847509 TTTGGGCTTTGCAGGTCACATGG + Intronic
986576007 5:9213730-9213752 TTTAGGCTTTGCAGTCCACATGG - Intronic
986758581 5:10859486-10859508 TTTGGGTTTTGCTGGCCATATGG + Intergenic
986926428 5:12758410-12758432 TTTAGGTTTTGCAGGCCAGCTGG - Intergenic
986957345 5:13169372-13169394 TTTAGTATTTGCAGGCCATACGG + Intergenic
987221638 5:15796431-15796453 TTTAGGCTTTGCAGGCCAAATGG - Intronic
987284274 5:16440408-16440430 TTTTGGTTTTGTGGGCCATATGG + Intergenic
987596518 5:20007952-20007974 TTTGAGCTTTGCAGGCCATATGG - Intronic
987745488 5:21966328-21966350 TTTAGTCTTTGCAGGCCATATGG + Intronic
988470722 5:31534604-31534626 TTTTAGGTTTGCTGGCTATATGG + Intronic
988514869 5:31895530-31895552 TTTTGTGATAGCAGCCCAGATGG + Intronic
989026782 5:37076978-37077000 TTTAGGCTTTGCAGGCCGTAAGG + Intergenic
989142106 5:38211579-38211601 TTTTGGCTTTGCAGACCATATGG - Intergenic
991275504 5:64842155-64842177 TTTAGGGTTTGTAGGCCACATGG - Intronic
991345705 5:65664964-65664986 TTTAGGCTTTGCAGGCCGTAAGG + Intronic
991765688 5:69976455-69976477 TTTAGTCTTTGCAGGCCATATGG + Intergenic
991781634 5:70141706-70141728 TTTAGTCTTTGCAGGCCATATGG - Intergenic
991844924 5:70851527-70851549 TTTAGTCTTTGCAGGCCATATGG + Intergenic
991874076 5:71142020-71142042 TTTAGTCTTTGCAGGCCATATGG - Intergenic
991911454 5:71566577-71566599 TTTTGGGTTTGCAGGCCAGATGG + Exonic
992188260 5:74264905-74264927 TTTAGGCTTTGCAGGCCTTATGG + Intergenic
992286053 5:75236728-75236750 TTTTTTGTTTGCGGGCAAGAGGG - Exonic
992334180 5:75748576-75748598 TTTTGTGTTTGTAGTACAGACGG - Intergenic
992491220 5:77246679-77246701 TTTTGGGTTTGCAGGCCATTTGG - Intronic
992536582 5:77711291-77711313 TTTAGGTTTTGCAGGCCATATGG - Intronic
992858246 5:80886242-80886264 TTTAGGCTTTGCAGACCATATGG - Intergenic
992920027 5:81505257-81505279 TTTAGGCTTTGCAGGTCACACGG - Intronic
993081213 5:83302637-83302659 TTGAGGGTTTCCAGGCAAGATGG - Intronic
993109766 5:83642982-83643004 TTTTGGCTTTGCTGGCCATATGG - Intronic
993398760 5:87422781-87422803 TTTGGGTTTTGCAGGCCAAATGG - Intergenic
993977129 5:94496368-94496390 TTTAGGCTTTGCAGCCCATAAGG - Intronic
994152008 5:96458331-96458353 TTTAGACTTTGCAGGCCATACGG - Intergenic
995084419 5:108090507-108090529 TTTAGGCTTTGCAGGCTATATGG + Intronic
995341411 5:111065220-111065242 TTTAGGCTTTGCAGGCCAGATGG + Intergenic
995377408 5:111491304-111491326 TTTAGGCTTTGCAGTCCATATGG - Exonic
995395911 5:111686676-111686698 GTTTCAGTCTGCAGGCCAGAAGG - Intronic
995562214 5:113394975-113394997 TTTTGGTTTTGTGGGCCATATGG - Intronic
995593378 5:113723124-113723146 TTTAAGCTTTGCAGGCAAGATGG + Intergenic
996039172 5:118791388-118791410 TTTAGGCTCTGCAGGCCATAAGG - Intergenic
996368660 5:122729723-122729745 GTTTGGATTGGTAGGCCAGAGGG - Intergenic
996491433 5:124102566-124102588 TTTTGGATTTGCACAGCAGATGG + Intergenic
996549389 5:124713648-124713670 TTTAGGCTTTGCAGGCCAAGAGG - Intronic
997011703 5:129885909-129885931 TTTAGGTATTGCAGGCCAAATGG + Intergenic
997436087 5:133876698-133876720 TTTTGGGAATGCAGCCCAGTAGG - Intergenic
998355738 5:141534732-141534754 TTTAGGCTTTGCAGGCCATATGG + Intronic
998572163 5:143271519-143271541 TTTAGGCTTTGCGGGCCATATGG + Intergenic
999353558 5:150902499-150902521 TTTTGGCATTGCAGGCCATACGG + Intronic
999934153 5:156467028-156467050 TTTAGGCTTTGCAGGCCAGATGG + Intronic
1000023688 5:157340673-157340695 TTTTAGCTTTGGAAGCCAGACGG - Intronic
1000082545 5:157861567-157861589 TTTTGGCTTTACATTCCAGATGG - Intergenic
1000267185 5:159648679-159648701 TTTTGACTTTGCAGGCCATATGG - Intergenic
1000325282 5:160167408-160167430 TTTTGGGAATGCAGCCCAGTAGG + Intergenic
1000422220 5:161051374-161051396 TTTTTGTTTTGCAGGCTACAAGG + Intergenic
1000691624 5:164328160-164328182 TTTAGGCTTTGCAAGCCAGATGG - Intergenic
1000903967 5:166940619-166940641 TTCAGGTTTTGCAGGCCATATGG - Intergenic
1001102780 5:168827928-168827950 TTTTAGCTTTGCAAGCCATATGG - Intronic
1001235417 5:170025385-170025407 TTTAGGCTTTGGAGGCCAGATGG - Intronic
1001240571 5:170066851-170066873 TTTAGGATTTGCAGGCCAGATGG - Intronic
1001717318 5:173826898-173826920 TTTAGGTTTTGCAAGCCATATGG - Intergenic
1002409546 5:179062695-179062717 TTTGGGCTTTGAAGCCCAGAAGG + Intronic
1002822846 6:743839-743861 TTGAGGCTCTGCAGGCCAGATGG - Intergenic
1002960144 6:1906675-1906697 TCCTGGGTTTGCAAGCCAGGGGG + Intronic
1003132589 6:3408128-3408150 TTCAGGCTTTGCAGGCCATATGG - Intronic
1003134622 6:3424825-3424847 TTTTGGCTTTGCAGGCCATGTGG - Intronic
1003492074 6:6631722-6631744 TTTAGGTTTTGCAGACCATATGG + Intronic
1003653361 6:7982987-7983009 TTTTGGGTTTTCAGTAGAGATGG - Intronic
1004297547 6:14427501-14427523 TTTTTGCTTTGCAGGCCACATGG - Intergenic
1004459019 6:15818227-15818249 CTGTGGGGTGGCAGGCCAGAGGG - Intergenic
1004479261 6:16003185-16003207 TTTAGGTTTTGCAGGCCACATGG + Intergenic
1004628106 6:17395242-17395264 TGTAGGTTTTGCAGGCCATATGG + Intronic
1004873128 6:19927724-19927746 TTTAGGCTTTGCAGGTCAGGAGG - Intergenic
1004914200 6:20316586-20316608 ATTAGGTTTTGCAGGCCACATGG + Intergenic
1005004417 6:21273522-21273544 TGTAGGCTTTGCAGGCCATATGG + Intergenic
1005615651 6:27570181-27570203 TTTAGGCTTTGCAGGCCATATGG - Intergenic
1005804912 6:29465471-29465493 TTTTGGGAATGCAGCCCAGCAGG - Intergenic
1006093495 6:31641982-31642004 TTGTGGGTGGGCAGGCCAGGTGG - Intronic
1006736725 6:36278989-36279011 TGTTGGGTGGGCTGGCCAGAAGG + Intronic
1007168995 6:39849174-39849196 TTTTGGCTTTGTGGGCCATACGG + Intronic
1008090969 6:47293453-47293475 TTTTAAGTTTGCAGGCCATAAGG - Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008402669 6:51081853-51081875 TTTAGGCTTTGCAGACCATAAGG - Intergenic
1008474696 6:51923311-51923333 TTTGGGGTTTGCAGACCACGTGG + Intronic
1008810266 6:55488139-55488161 TTTTGGGCTAGGAGGACAGAGGG + Intronic
1009197905 6:60709430-60709452 TTTTAGACTTGCAGGCCATAAGG - Intergenic
1010255554 6:73753205-73753227 TTTAGGCTTTGCAGGCCATATGG - Intronic
1010398881 6:75425994-75426016 TTTAGGCTTTGCAGGCCATACGG + Intronic
1010732781 6:79408883-79408905 TTCTCGGTTTGCAGAGCAGAGGG + Intergenic
1011053070 6:83175222-83175244 TTTTGGATTTTCAGGCCATAAGG - Intronic
1011053153 6:83176422-83176444 TTTAGGCTTTGCAGGCCATATGG + Intronic
1011220608 6:85051030-85051052 TTTTGGCATTGTAGGCCACAGGG - Intergenic
1011273789 6:85607440-85607462 TTTTGAGTTTTCAGGGCAGAAGG - Intronic
1012195053 6:96331201-96331223 TTTAGGCTTTGCAGGCCAGATGG + Intergenic
1013471748 6:110472393-110472415 TTTGGGTTTTGCAGTGCAGAGGG - Intronic
1014173165 6:118301735-118301757 TTTAGGCTTTGCAGGCCATACGG + Intronic
1014498568 6:122157927-122157949 TTTAGGATTTGCAGGCCACATGG - Intergenic
1014648667 6:124007914-124007936 TTTTGGGGTTACAGGCAAAAAGG + Intronic
1014973887 6:127854325-127854347 TTTTAGGTTTTGTGGCCAGAGGG - Intronic
1015142491 6:129950826-129950848 ATTTGGTTTTGCAGCCAAGAAGG + Intergenic
1015658341 6:135545307-135545329 TTATGGCTTTGCAGGCCACATGG - Intergenic
1015789345 6:136950888-136950910 TTTAGGTCTTGCAGGCCACATGG + Intergenic
1015890068 6:137961573-137961595 TTTTGGCTTTGTAGGCCATATGG - Intergenic
1016332496 6:142968360-142968382 TGTTAGGTTTGCAAGCCAGATGG - Intergenic
1016420782 6:143880623-143880645 TTTTGGCTTTGCAGGTCATATGG + Intronic
1017071587 6:150579790-150579812 TGTTGGCTTTGGACGCCAGACGG + Intergenic
1018231127 6:161676633-161676655 TTTGGATTTTGCAGGCCATAGGG - Intronic
1018887540 6:167952562-167952584 TTTAGGCTTTGCAGGCCACGGGG + Intronic
1019204321 6:170346543-170346565 TTCAGGCTTTGCAGGCCACATGG + Intronic
1019642993 7:2114779-2114801 TTTGGGGTTTGCCGGGCAGGTGG - Intronic
1019763306 7:2830390-2830412 TTTTGGGTTTGTAGCCAAGTAGG + Intronic
1019864126 7:3689125-3689147 GTTAGGGTTTGCAGGCCATATGG - Intronic
1020699185 7:11456663-11456685 TTTTGGCTTTGTAGGCCATATGG + Intronic
1020988736 7:15169218-15169240 TTTTGGCTTTGCAAGCCAGGTGG + Intergenic
1021262060 7:18470597-18470619 TTTGGGCTTTGCAGGCTATATGG + Intronic
1021266337 7:18528447-18528469 TTCTGGGTTTTCAGACCAAATGG + Intronic
1021548602 7:21844530-21844552 TTTTGGCTTTGTAGGCCATAAGG - Intronic
1021579524 7:22138369-22138391 TTTAGGTTGTGCAGGCCACATGG - Intronic
1021691471 7:23234670-23234692 TTTTGGCTTTGTGGGCCATATGG - Intergenic
1021850326 7:24801761-24801783 TGTTGGTTTTGCAGGCCATCAGG - Intronic
1022185001 7:27958749-27958771 ATTTGATTTTGCAGTCCAGACGG + Intronic
1022319852 7:29278327-29278349 TTTAGGCTTTGCAGACCATATGG + Intronic
1022654006 7:32302097-32302119 TTTTGGCTTTGCAGGCCATATGG - Intergenic
1022681822 7:32555641-32555663 TTTTTGCTTTGCGGGCCATATGG - Intronic
1023157301 7:37263769-37263791 TCTGGGGTCTGCAGGCCAGGGGG + Intronic
1023457426 7:40355538-40355560 TTTAGGCTTTGCAGGCCAAGAGG + Intronic
1023518397 7:41026459-41026481 TTTTGGGAGTCCAGGGCAGAAGG + Intergenic
1023554218 7:41403447-41403469 GGGTTGGTTTGCAGGCCAGAGGG - Intergenic
1023670789 7:42574525-42574547 TTTAGGCTTTGCAGGCCATCTGG - Intergenic
1023774488 7:43591442-43591464 TTTTGGCTTTGTGGACCAGAGGG - Intronic
1024037012 7:45515482-45515504 TTTTGGATTTGGAGGACAAATGG + Intergenic
1024277612 7:47691390-47691412 ACTTGGGCCTGCAGGCCAGATGG + Intergenic
1025122383 7:56316202-56316224 TTTAAGCTTTGCAGGCCATACGG - Intergenic
1025159861 7:56647108-56647130 TTTTGGGTATGCAGTGGAGAGGG - Intergenic
1025164164 7:56695986-56696008 TTTTGGGCTTGCAGTGGAGATGG - Intergenic
1025637299 7:63333871-63333893 TTTTGTGTTTGTAGGAGAGATGG - Intergenic
1025645396 7:63414228-63414250 TTTTGTGTTTGTAGGAGAGATGG + Intergenic
1025706118 7:63866085-63866107 TTTTGGGCTTGCAGTGGAGATGG + Intergenic
1025726858 7:64072228-64072250 TTTTGGGTATGCAGTGGAGAGGG + Intronic
1025807575 7:64849755-64849777 TTTTGGGGTTGCATGAGAGATGG - Intergenic
1026176243 7:68000218-68000240 TTTAGGGTTTGCAGGCCCCATGG + Intergenic
1026203875 7:68238657-68238679 TGCTGGGATTGCAGGCCAGGCGG - Intergenic
1027132594 7:75601758-75601780 TTTAGGCTTTGCAGGCCGCATGG - Intronic
1027196926 7:76037141-76037163 TTTTGGGTGTCCAAGGCAGAAGG + Intronic
1027398603 7:77784662-77784684 CTTTGGGTTGGCGGGGCAGAAGG - Intergenic
1027451349 7:78335096-78335118 TTTAGGTTTTGCAGACCAGATGG - Intronic
1028105798 7:86877019-86877041 TTTTGGCTTTGCAGGGCATGTGG - Exonic
1028462886 7:91116026-91116048 TGTTGGGGTTTCAGGACAGAGGG - Intronic
1029602653 7:101578048-101578070 TTTAGGCTTTGCAGGCCATATGG - Intergenic
1029659541 7:101950677-101950699 TTTAAGTTTTGCAGGCCATATGG - Intronic
1030540787 7:110828130-110828152 TTTAGGCTTTGTAGGCCAGATGG + Intronic
1030818540 7:114067425-114067447 TTTTAGCTTTGCAGGTCATATGG - Intronic
1031016763 7:116584051-116584073 TTTAGGCTTTGCAGGTCATATGG + Intergenic
1031101192 7:117481760-117481782 TTTTAGAATTGCAGTCCAGAAGG - Intronic
1031162493 7:118184448-118184470 TTTGGGTTTTGCAGGCAAAATGG - Intronic
1031456135 7:121981661-121981683 TTCAGGGTTTGAAGGCCAGATGG + Intronic
1032081190 7:128859317-128859339 TTTTCGTGTGGCAGGCCAGAGGG - Intergenic
1033444358 7:141407138-141407160 TTTCAGATTTGCAGGCCATATGG - Intronic
1033894014 7:146050272-146050294 TTCTGGTTTTGCAGGCCAGGTGG - Intergenic
1033963780 7:146948282-146948304 TTTAGGCTTTGCAGGCAACATGG - Intronic
1034328484 7:150260149-150260171 TTTCGATTTTGCAGGCCACAAGG - Intronic
1034330953 7:150281884-150281906 TTTTGGCTCTGCAGGCCGTATGG - Intronic
1034667091 7:152827969-152827991 TTTTGGCTCTGCAGGCCGTATGG + Intronic
1034691122 7:153014615-153014637 TTTTGGATTTGCAGTAGAGATGG + Intergenic
1034764726 7:153709243-153709265 TTTCGATTTTGCAGGCCACAAGG + Intergenic
1034861794 7:154601848-154601870 TTTTGGTTTTTCAAGCCATACGG - Intronic
1036164242 8:6417293-6417315 TTTAGGCTTTGCGGGCCATATGG + Intronic
1036212427 8:6853264-6853286 TTGGGGGTTCACAGGCCAGATGG - Intergenic
1036469014 8:9033420-9033442 TTTTGGCCTTGCTGGCCAGATGG - Intronic
1036586902 8:10132919-10132941 ACTTGGGCTAGCAGGCCAGAAGG + Intronic
1036593080 8:10186290-10186312 TTTAGGCTTTGCAGGCCATACGG + Intronic
1037800080 8:22028256-22028278 TTTTAGGTTTGCAAACCATATGG - Intronic
1038977800 8:32720413-32720435 TATTTGCTTTGCAGGCTAGACGG + Intronic
1039206853 8:35165640-35165662 TTTTAGGCTTTGAGGCCAGAAGG - Intergenic
1039747922 8:40447882-40447904 TTTTGGCTTTGTGGGCCACATGG - Intergenic
1039880003 8:41619431-41619453 TTTAGGATTTGCAGGCCATATGG + Intronic
1040913633 8:52545771-52545793 TTTTTGGTTTACAGTACAGAGGG + Intronic
1041409023 8:57533502-57533524 TTTTGGGTTTTCAGGATAGCGGG + Intergenic
1042330927 8:67579881-67579903 TTTTCGGTTTGAGGGCCATATGG - Intronic
1042893528 8:73640475-73640497 TTTAGGCTTTGCAGGCCATAAGG + Intronic
1043349169 8:79339615-79339637 TTTAGGCTTTGCAGGCCTTATGG - Intergenic
1043451220 8:80368911-80368933 TTTAGGCTTTGCAGGCCAAAAGG - Intergenic
1044096400 8:88071868-88071890 TTTAGGCTTTGCAGCCCATATGG - Intronic
1044519776 8:93186088-93186110 TTTTGGCTTTGCAGGTCATATGG - Intergenic
1045382212 8:101638538-101638560 TTTAGACTTTGCAGGCCATATGG - Intronic
1045657773 8:104404843-104404865 TTTTGGCTTTGTGGGCCATATGG - Intronic
1045751866 8:105494826-105494848 TTTTAGGTTTTTAGGCCAAAAGG + Intronic
1045961152 8:107970117-107970139 TTTAGGCTTTGCAGACCATACGG + Intronic
1046122760 8:109866170-109866192 TTGTGGGTTTCCAATCCAGAAGG - Intergenic
1046582475 8:116110561-116110583 TTGTGGGTTTCCAGGCTTGAGGG - Intergenic
1046892462 8:119437832-119437854 TTTAGGCTTTGCGGGCCATATGG + Intergenic
1047053229 8:121136689-121136711 TCTTTTGTTTGCAGGCCATAAGG - Intergenic
1047621216 8:126610077-126610099 TTTAGGCTTTGCAGGCCATATGG + Intergenic
1047637485 8:126780281-126780303 TTTTGGATTTGCAGACCTGAGGG - Intergenic
1047692955 8:127375120-127375142 ATTTTAGGTTGCAGGCCAGATGG - Intergenic
1047779114 8:128097498-128097520 TTTAGGCTTTGCTAGCCAGATGG - Intergenic
1048474534 8:134731449-134731471 TTTCAGCTTTGCAGGCCATATGG + Intergenic
1049018025 8:139935183-139935205 TTTTGGGGTTCTAGGACAGAAGG - Intronic
1050151012 9:2619670-2619692 TTTTCAGTTTACAGGCCAAAAGG + Intergenic
1050517701 9:6462251-6462273 TTTTGGCTTTGCAGGCTAGATGG - Intronic
1050621377 9:7455625-7455647 TTTTGGCTTTGCTGGCCATATGG + Intergenic
1051808789 9:21027294-21027316 TTTGGGGTTTGCATTGCAGAGGG + Intronic
1052161520 9:25266352-25266374 TTTAGGCTTTGTAGGCCATATGG - Intergenic
1052674485 9:31602316-31602338 TTTCGGATTTGTAGGCCATATGG - Intergenic
1053389923 9:37727314-37727336 TTTAGGTTTTGCAGGCCACAGGG + Intronic
1054946546 9:70802324-70802346 TTTTCTGTTTTCAGGCCAGATGG + Intronic
1054999925 9:71437561-71437583 TTTAGGTTTTGCAGGCTATAAGG - Intronic
1055525677 9:77130868-77130890 TTAAGGCTTTGCAGCCCAGATGG - Intergenic
1055912582 9:81369243-81369265 TAGTGGCTTTGCAGGCCAGATGG - Intergenic
1056106259 9:83349603-83349625 CTTTGGTCTTGCAGGCTAGATGG - Intronic
1057314986 9:93962162-93962184 TTTAGACTTTGCAGGCCACATGG + Intergenic
1057506921 9:95642315-95642337 TTTTGGCTTTGCAGGTCATATGG + Intergenic
1057953681 9:99390267-99390289 TTTAGGCTTTGCAGGCCATACGG - Intergenic
1058071394 9:100603970-100603992 TTTTGGCTTTGCAGAACATATGG - Intergenic
1058107656 9:100991063-100991085 GTTTTGTTTTGCAGGCCATATGG - Intergenic
1058451663 9:105102041-105102063 TTTAGGTTTTCCAGGCCATATGG - Intergenic
1058997791 9:110316837-110316859 TTTAGGCTTTGCAGGCCATTTGG + Intronic
1059420230 9:114186069-114186091 CCTTGGGTTTGCCTGCCAGAAGG + Intronic
1059819806 9:117959110-117959132 TTTTGGCTTTGTGGGCAAGATGG + Intergenic
1060223769 9:121778670-121778692 TTTAGGCTTTGTAGGCCATATGG + Intronic
1060943899 9:127558639-127558661 TTTGGGGTGGGCAGGCCTGATGG - Intronic
1061686841 9:132287635-132287657 TTTAGGCTTTGCAAGCCATATGG - Intronic
1185773987 X:2787508-2787530 GCTTTGGTTTCCAGGCCAGAAGG - Intronic
1185970677 X:4659112-4659134 TTTAGGCTTTGCAGACCACATGG + Intergenic
1186119140 X:6339683-6339705 TTTTGGCTTTGTAGACCATAAGG + Intergenic
1186318962 X:8403335-8403357 TTTAGGCTTTGCAGGCCTCAGGG - Intergenic
1186518754 X:10186880-10186902 TTTGGGCTTTGCGGGCCGGATGG - Intronic
1186525379 X:10243395-10243417 TTTGGGCTTTGTAGGCCAGATGG - Intergenic
1186526643 X:10255210-10255232 TTCGGGTTTTGCAGGCCAAAAGG + Intergenic
1186547986 X:10471031-10471053 TTTAGGCTTTGCAGTCCATATGG - Intronic
1186555066 X:10549540-10549562 TTCTGGCATTGCAGGCCATATGG - Intronic
1186557035 X:10570689-10570711 TTTTGGCTTTGTGGGCCAAAGGG + Intronic
1186691485 X:11981061-11981083 TTTAGGCTTTGTAGGCCAGATGG - Intergenic
1186706354 X:12143480-12143502 TTTAGGCTTTGTAGGCCATAAGG - Intronic
1186873403 X:13793882-13793904 TTCTGAGTTTGCAGGCCATGAGG - Intronic
1186951657 X:14632960-14632982 TTTTAGGCTTGCAAGCCATAAGG + Intronic
1186965296 X:14780632-14780654 TTTAGGCTTTGCAAGCCAGATGG + Intergenic
1186995342 X:15115422-15115444 TTTAGGCTCTGCAGGCCACATGG + Intergenic
1187080557 X:15982304-15982326 TTTAGGCATTGCAGGCCAGACGG - Intergenic
1187392485 X:18895280-18895302 ATATGGGTTTCCAGGGCAGAGGG - Intronic
1187563098 X:20420705-20420727 TTCAGGCTTTGCAGGCCATAGGG + Intergenic
1187578654 X:20585327-20585349 TTTCATGTTTGCAGGCCATATGG - Intergenic
1187581491 X:20612142-20612164 TTTTTTTTCTGCAGGCCAGAGGG + Intergenic
1187713589 X:22078681-22078703 TTTAGGGTTTGCAGGCCGTCTGG + Intronic
1187793980 X:22981056-22981078 TTTTGGCTTTGTGGGCCATACGG - Intergenic
1188516829 X:30996761-30996783 TTTAGGCTTTGCAGACCACATGG - Intergenic
1188595184 X:31891711-31891733 TTTAGGCTTTGCAGGCCAATAGG - Intronic
1188865341 X:35306604-35306626 TTTTGATTTTGCAGGCCAATAGG + Intergenic
1189103074 X:38211016-38211038 TTTCAGCTTTGCAGGCCATATGG + Intronic
1189142019 X:38617018-38617040 TTTAGGTTTTGCAGGGCACAGGG + Intronic
1189339706 X:40195442-40195464 TTTAGGCTTTGCAGGCCATATGG + Intergenic
1189624611 X:42883045-42883067 TTTAGGCTTTGCAGGCTATACGG + Intergenic
1189778279 X:44489609-44489631 TTTAGGCTTTGCAGCCCATATGG + Intergenic
1189813583 X:44802854-44802876 TTTCAGGCTTGCAGACCAGATGG - Intergenic
1189881698 X:45500615-45500637 TTTTGGCTTTGCAGGTCATGTGG + Intergenic
1190969143 X:55332094-55332116 TCTTTGGTTTGCTGGGCAGATGG - Intergenic
1191029080 X:55948250-55948272 TTTAGGCTTTGCAGGCCATATGG + Intergenic
1192268728 X:69558337-69558359 CTTTGGGTCTGAAGGCAAGATGG + Intergenic
1192531448 X:71890460-71890482 TTTAGGCTTTGTAGGCCATATGG - Intergenic
1194696317 X:97055550-97055572 TTATGGGTCTGCAACCCAGAGGG + Intronic
1195025334 X:100871288-100871310 TTTAGGCTTTGCAAGCCATATGG - Intronic
1195043725 X:101037314-101037336 TTAGGGCTTTGCAGGCCATATGG + Intronic
1195590996 X:106626926-106626948 TTTAGGCTTTGCAGGCCATATGG + Intronic
1195743763 X:108092597-108092619 TTTAGGCTTTGTAGGCCAAAAGG + Intronic
1195749978 X:108154432-108154454 TTTGGGCTTTGCAGGCCATGCGG + Exonic
1197650347 X:129057262-129057284 TTTAGGTTTTGCAGGCTAAATGG - Intergenic
1197683674 X:129415451-129415473 TTTAGGCTTTGCATGCCAGGGGG + Intergenic
1198386531 X:136134304-136134326 TTTTTTTTTTTCAGGCCAGATGG + Intergenic
1198424402 X:136501312-136501334 TTTAGGCTTTGTAGGCCACAAGG - Intronic
1198514397 X:137390108-137390130 TTTAGGCTTTGCAGGTCATATGG + Intergenic
1198558077 X:137817468-137817490 TTTAGTTTTTTCAGGCCAGAGGG + Intergenic
1198801912 X:140456892-140456914 TTTAGGCTTTGTAGGCCACATGG - Intergenic
1199925081 X:152453913-152453935 TTTTTGGTTTGCAGTCAAGTGGG - Intergenic
1200668093 Y:6053182-6053204 TTTGGAGGTTGGAGGCCAGATGG - Intergenic
1201295753 Y:12461879-12461901 GCTTTGGTTTCCAGGCCAGAAGG + Intergenic
1201612347 Y:15857410-15857432 TTTCGGCTTTGCAGGCCATCTGG + Intergenic