ID: 991915543

View in Genome Browser
Species Human (GRCh38)
Location 5:71601138-71601160
Sequence ATGCAATCTAGTATTTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991915539_991915543 15 Left 991915539 5:71601100-71601122 CCAAAATAATAGATGCTGGGTAG 0: 1
1: 0
2: 0
3: 15
4: 138
Right 991915543 5:71601138-71601160 ATGCAATCTAGTATTTTTGTGGG 0: 1
1: 0
2: 0
3: 22
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991915543 Original CRISPR ATGCAATCTAGTATTTTTGT GGG Intronic
902730233 1:18364359-18364381 AGGAAATGTAGGATTTTTGTCGG - Intronic
906973896 1:50548253-50548275 ATGTAATCTAGTATATTACTGGG + Intronic
908486784 1:64602732-64602754 ATGTAAACCATTATTTTTGTTGG + Intronic
909171317 1:72299499-72299521 ATTCATTCTTGTCTTTTTGTAGG + Intergenic
909848053 1:80422527-80422549 ATGCTAGCTCATATTTTTGTTGG - Intergenic
909881703 1:80887999-80888021 ATACAATCTATTATTTTTAAAGG - Intergenic
910264821 1:85327416-85327438 ATGTAATCTAGTAGTGTTGCAGG + Intronic
910476866 1:87616726-87616748 ATTAAATCTAATATTTTTGTGGG + Intergenic
911035256 1:93537044-93537066 GTGATATCTAGTATTTTTGTAGG - Intronic
911272870 1:95824991-95825013 ATGTAATCTAGTATATTGGAGGG + Intergenic
911424460 1:97689602-97689624 ATGAAATGAACTATTTTTGTGGG - Intronic
912268403 1:108183730-108183752 TTGCATTTTTGTATTTTTGTTGG - Intronic
912726896 1:112066902-112066924 ATGCCGTCTAGTGTGTTTGTAGG - Intergenic
912737505 1:112163016-112163038 ATGCAATATCTTATTTTTTTGGG - Intergenic
912924188 1:113899125-113899147 CTGCAATGGAGTATTTTTGTGGG + Intronic
914773514 1:150714483-150714505 ATGCTAGATAGCATTTTTGTAGG - Intronic
915452322 1:156014796-156014818 CTGTAATCTAGCATTTTTGGAGG - Intronic
916323043 1:163526712-163526734 AAGCAATCTTGTATATTTTTGGG - Intergenic
918352766 1:183674745-183674767 ATGCAACCTATCATTTCTGTGGG - Intronic
918418209 1:184334559-184334581 ATGCAATTTAGTATGTTATTTGG - Intergenic
918878258 1:190079974-190079996 ATGCAATTTAGTCTTGTTCTAGG - Intergenic
922130001 1:222768128-222768150 ATGGAGTGTAATATTTTTGTAGG - Intergenic
922197544 1:223372731-223372753 ATCCCATGTATTATTTTTGTAGG + Intergenic
923276641 1:232402510-232402532 AGTCAATCGAGCATTTTTGTTGG + Intronic
924259041 1:242211171-242211193 ATGCCATCTAGGACTTTTGTGGG + Intronic
1065621241 10:27584378-27584400 ATGCATACTAGTATTTATGGAGG + Intergenic
1069803861 10:71104885-71104907 ATGCAATGTAGTATTGTGGATGG + Intergenic
1069844373 10:71360693-71360715 ATGTATACTAGTATTTTGGTAGG - Intronic
1075251981 10:120887232-120887254 TTACAATCTAGTATTATTTTTGG + Intronic
1075408783 10:122212165-122212187 CTGGAATCTACTATGTTTGTAGG - Intronic
1079484038 11:20915132-20915154 ATACAGTCTAGTAATTCTGTTGG + Intronic
1079685597 11:23355279-23355301 ATGCAAGGTATTAATTTTGTGGG + Intergenic
1079753284 11:24225339-24225361 ATGCAATGCAGTATTTTCATAGG + Intergenic
1080081692 11:28227204-28227226 AGGCAATCTACTAGTTTTGACGG + Intronic
1080679032 11:34456584-34456606 TTGAAATCTGGTATTTTTGTGGG + Intronic
1081242495 11:40724127-40724149 ATGTAATTAAGTATTTTTGCAGG - Intronic
1084802973 11:71557554-71557576 CTGCAATCTAATATTTTACTGGG + Intronic
1086978194 11:93162057-93162079 ATGTAATCTATTATTTTATTAGG + Intronic
1087860492 11:103148427-103148449 ATGTAACTTAGTATTTTTGATGG + Intronic
1088631158 11:111775118-111775140 CTGAAATCTACTATTTATGTTGG - Intergenic
1089193143 11:116670043-116670065 ATGGTAGCTTGTATTTTTGTGGG - Intergenic
1089586139 11:119511026-119511048 ATGCAAGCAGGTATTTTTGGGGG + Intergenic
1092851628 12:12633621-12633643 ATTGTATCTAGCATTTTTGTGGG - Intronic
1093357980 12:18192992-18193014 TTGCAATCTAGTATTTCTAAGGG + Intronic
1093680624 12:21997789-21997811 ATGGAATTTATTATTTTTATAGG - Intergenic
1094716782 12:33021787-33021809 ATGTATTCTACTATTTTTGAAGG - Intergenic
1095278472 12:40320116-40320138 AAGCAATCTGGAATTTTTCTAGG - Exonic
1097838318 12:64296203-64296225 TTGCAATCTAGGCTTTTTCTAGG - Intronic
1098788679 12:74792189-74792211 ATGCATTCTAGTAATTCTTTTGG + Intergenic
1103291635 12:119850921-119850943 ATCCAATCTACTGTCTTTGTTGG - Intronic
1103841854 12:123871513-123871535 AAGCAACCTGTTATTTTTGTTGG + Exonic
1106766929 13:32922525-32922547 AAACAATGTAGTATTTTAGTTGG + Intergenic
1106873204 13:34043946-34043968 ATGCAATCTAATATATTCATAGG - Intergenic
1110038823 13:70724750-70724772 ATTCAATTTACTTTTTTTGTAGG + Intergenic
1110266541 13:73543694-73543716 ATCCAGTCTAATATTCTTGTTGG + Intergenic
1110291913 13:73817518-73817540 ATTCAATTTAATATTGTTGTAGG - Intronic
1111677745 13:91407574-91407596 CTGCAAAATAGTATTTTTCTAGG + Intronic
1112981572 13:105391490-105391512 ATGCAATCTTTTATCTTGGTTGG - Intergenic
1114814079 14:25935815-25935837 ATCCAATCTATTATATTAGTTGG + Intergenic
1117331197 14:54713465-54713487 ATGCTATAAAGGATTTTTGTGGG + Intronic
1117492170 14:56260080-56260102 AGGCAATCTGGAATTTTTATTGG - Intronic
1117743665 14:58845485-58845507 ATGAAAACTAGTGATTTTGTGGG + Intergenic
1123815788 15:23977423-23977445 ATGAAAGCTAGAATTTTTGTAGG + Intergenic
1125044963 15:35234746-35234768 AAGTAATTCAGTATTTTTGTTGG + Intronic
1125284487 15:38077204-38077226 ATACAAACTTGTATTCTTGTTGG - Intergenic
1129544771 15:76383877-76383899 ATGCAATCTTGTATTGTCGAGGG + Intronic
1134765904 16:16757816-16757838 ATGCAAACTCTTATTCTTGTAGG + Intergenic
1134980145 16:18601398-18601420 ATGCAAACTCTTATTCTTGTAGG - Intergenic
1138923497 16:61562514-61562536 ATCCAATGTAGTATTTTGGATGG - Intergenic
1141870443 16:86781748-86781770 ATGAATTATAGTAATTTTGTGGG - Intergenic
1146780842 17:35670702-35670724 TTGTAATCTAGAATTTTTTTAGG + Intronic
1148407392 17:47429006-47429028 ATGGAAGATAGTATTATTGTTGG + Intronic
1149114718 17:53079237-53079259 ATGCAAACCATTATTTTTGTTGG - Intergenic
1149373811 17:56023322-56023344 CTGCAATGCAGTATTATTGTGGG - Intergenic
1154966273 18:21359942-21359964 ATGCAATAAAGTAATTTGGTAGG + Intronic
1156823408 18:41400551-41400573 ATCACTTCTAGTATTTTTGTAGG - Intergenic
1157771631 18:50352814-50352836 ATGCCAGCTAATTTTTTTGTAGG - Intergenic
1157937692 18:51891444-51891466 ACGTAATCTTGTGTTTTTGTTGG + Intergenic
1158119604 18:54033897-54033919 AAGCAATCTAGTATCTATTTTGG - Intergenic
1158451143 18:57566558-57566580 ATCCAATATAGTATTTGTGAGGG + Exonic
1158916055 18:62131096-62131118 ATACAAGCTAGTATTTAAGTTGG + Intronic
1167775956 19:51555912-51555934 ATTCATTCTAATAGTTTTGTGGG + Intergenic
1202666154 1_KI270708v1_random:121591-121613 TGGCAATATAGTATTCTTGTGGG - Intergenic
925077936 2:1034266-1034288 ATGAGATCAAGTTTTTTTGTAGG - Intronic
927378265 2:22444672-22444694 ATTTAAAGTAGTATTTTTGTAGG - Intergenic
928812938 2:35250974-35250996 TTGCAATATAGTATTCTTTTTGG - Intergenic
929823041 2:45288773-45288795 ATCCAATTTAATATTTTTGATGG - Intergenic
929824990 2:45303106-45303128 GTGCAATCTAGTGTCTTTGTGGG + Intergenic
929937244 2:46302331-46302353 AGGAAATCTAGTAGTTTTTTGGG + Intronic
931605622 2:64049436-64049458 CTGCAATTTGGGATTTTTGTAGG + Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
936343955 2:111661160-111661182 GTGTAATGTAGTATTATTGTTGG - Intergenic
939185643 2:138857486-138857508 ATTTATTCTAGTATTTTTTTTGG - Intergenic
939697832 2:145349730-145349752 ATGCACTTTGGTAGTTTTGTGGG + Intergenic
939736143 2:145849142-145849164 ATGCAAATTAGATTTTTTGTTGG + Intergenic
942158670 2:173159030-173159052 GTGCAATCAAGTCATTTTGTAGG + Intronic
942202622 2:173587021-173587043 TTGCAATTGAGTATTTTTGTTGG + Intergenic
945164353 2:206926749-206926771 ATGCAATGGACTAATTTTGTAGG + Intergenic
945662917 2:212708476-212708498 ATGCAATCTCCTATTCTTGCAGG - Intergenic
946083906 2:217151791-217151813 ATTCTATCTAGTATTTTAATGGG + Intergenic
946500446 2:220241815-220241837 AAGCAATCTCGTGTTTTTGTTGG + Intergenic
946913561 2:224490747-224490769 AAGCAAACTAATATATTTGTAGG - Intronic
1169025639 20:2368880-2368902 CTGCACTCTAGTGTTATTGTTGG + Intergenic
1170095791 20:12644584-12644606 AGGCAATATAATATTCTTGTTGG - Intergenic
1173056664 20:39621052-39621074 ATGAGTTCTAGTATTTTTGTGGG - Intergenic
1173572947 20:44089394-44089416 ATACAATGAAGTATTTTTGTGGG + Intergenic
1175477407 20:59286641-59286663 ATGCCTTCTAGGATTTTGGTGGG - Intergenic
1177694885 21:24558146-24558168 ATGCTATTTTGTATTTCTGTGGG - Intergenic
1184305365 22:43596703-43596725 ATGTCATTTGGTATTTTTGTAGG - Intronic
1184905336 22:47481073-47481095 ATGCTAGCTAGGATTTTTATGGG - Intronic
949380706 3:3442378-3442400 CTGTAATCTAGAATTTTGGTAGG - Intergenic
952046013 3:29321424-29321446 TTGCAATCTGATATCTTTGTGGG - Intronic
952084868 3:29807480-29807502 ATGCATGCTATTATTTCTGTGGG - Intronic
953155347 3:40366249-40366271 ATGCAAACTATTATAATTGTAGG - Intergenic
953675568 3:44999063-44999085 ATGCACACTTGTAGTTTTGTAGG + Intronic
954503020 3:51038862-51038884 ATGTATTCTAGTTTTTTTTTTGG + Intronic
955665668 3:61346812-61346834 AAGTTATCTAATATTTTTGTGGG + Intergenic
956472818 3:69586081-69586103 ATGAAAACTAGTAGCTTTGTTGG + Intergenic
956474316 3:69603594-69603616 ATTCAATCTAGGACATTTGTTGG + Intergenic
957181122 3:76878812-76878834 ATGCAGTTTAGGATTTTTGATGG - Intronic
958122186 3:89305315-89305337 ATGCAAAATAATATTTTTCTTGG - Intronic
959313280 3:104769099-104769121 ATGAAAGCTAGTATTTATTTTGG - Intergenic
959767561 3:110049755-110049777 ATGCACTTTTGTATTTTTATTGG + Intergenic
960426703 3:117516939-117516961 ATGCAATCAAGGTTTTCTGTTGG - Intergenic
960648169 3:119913457-119913479 ATGCAATGAAGTATTTTAGTAGG - Intronic
960884700 3:122382733-122382755 GTGCAATTTACTATTTTTGTGGG - Intronic
962064188 3:131962034-131962056 AAACAATCTAGTACTTTTTTAGG - Intronic
962223506 3:133584814-133584836 ATGCATTCTAGTCTTTTCGTGGG - Intronic
962407730 3:135114403-135114425 ATGCAATATACTATTTAGGTTGG + Intronic
963015596 3:140821085-140821107 ATGCAATCAGATATGTTTGTTGG - Intergenic
963252715 3:143117904-143117926 ATGCAATTCAGTTTTTTTCTGGG + Intergenic
963871605 3:150421343-150421365 ATTCAATCTGGTTTTTTTTTTGG - Intronic
964594191 3:158404133-158404155 ATCAAATTTAGTATTTTTATTGG + Intronic
965184215 3:165442819-165442841 ATGCAATATATAATTTTAGTAGG - Intergenic
965523903 3:169696805-169696827 ATGGAATATAGTATTTGTGAGGG + Intergenic
966282735 3:178252597-178252619 ATTCTATATAGTATTTTTCTTGG + Intergenic
966499412 3:180622290-180622312 ATCCAATCTAAGATTTTTTTTGG + Intronic
966507794 3:180726552-180726574 AAGCAGTCTAGTATTTTGTTAGG - Intronic
967532916 3:190569808-190569830 AAGGAAACCAGTATTTTTGTAGG + Intronic
970486584 4:16530787-16530809 ATGCCATCTACTATTTTAGGGGG + Intronic
973098933 4:46237653-46237675 ATGTAATCTATTATGTGTGTAGG - Intergenic
974706549 4:65524795-65524817 ATACAATCTGTTATTTTTCTTGG - Intronic
974760665 4:66269578-66269600 ATGCCAGTTTGTATTTTTGTGGG - Intergenic
975561481 4:75711852-75711874 TAGCAAACTAGTAGTTTTGTTGG + Intronic
975803176 4:78084173-78084195 ATACAATCAAATATTTTTTTGGG + Intronic
976192755 4:82504196-82504218 ATGCCATCTACTATTTTTTGGGG + Intronic
976220131 4:82750148-82750170 ATGAAAGCAAATATTTTTGTGGG - Intronic
976986301 4:91303374-91303396 ATGTAATGTAGTATTTTGGATGG + Intronic
977603589 4:98959822-98959844 ATGCAATATAATTTTTTTTTCGG - Intergenic
979425249 4:120556272-120556294 AAGCAATCTAGGATTATTTTTGG - Intergenic
979803727 4:124944228-124944250 ATGCACTCGAGTATTCTTTTTGG + Intergenic
979908154 4:126324081-126324103 ATGCACTGTAGCATTTTTGAAGG - Intergenic
980146428 4:128990706-128990728 ATCCAATCTAATAGTTTTGTTGG - Intronic
980539040 4:134169385-134169407 ATGAAATTGAGTATCTTTGTTGG - Intergenic
981292947 4:143097680-143097702 ATGTAATCTAGTGTATATGTTGG - Intergenic
981827685 4:148962556-148962578 ATGCAAACTAGTAATTAAGTAGG - Intergenic
982571656 4:157058031-157058053 ATGCAATCTGGTATTTTAATAGG + Intergenic
982689482 4:158531888-158531910 ATGCAATCTGGGTTTTCTGTTGG + Intronic
982822303 4:159956202-159956224 ATGCAATCTATTATGTTTTCTGG + Intergenic
983530425 4:168804673-168804695 ATGGAAATTAGTATTTCTGTTGG + Intronic
986461459 5:7976722-7976744 ATTCATTCTAGTATTTTTAATGG + Intergenic
987950959 5:24675194-24675216 ATGCTAAATAGTATTTTTGATGG + Intergenic
987960432 5:24801272-24801294 GTGCAATCTAGGCTTTTTATTGG + Intergenic
988228642 5:28447114-28447136 ATGCAATATTGTTTTTTTCTAGG - Intergenic
988314565 5:29607403-29607425 ATGTTATCGAGTATTTTTGATGG - Intergenic
989803834 5:45580131-45580153 ATGTAATCTAATATTTTCCTAGG - Intronic
990784193 5:59400844-59400866 ATGTTAGCTATTATTTTTGTTGG - Intronic
991915543 5:71601138-71601160 ATGCAATCTAGTATTTTTGTGGG + Intronic
992108130 5:73467374-73467396 ATGCATTTTAGTTTTTTTCTAGG + Intergenic
992879233 5:81088724-81088746 TAGCAATATAGTATGTTTGTGGG - Intronic
993078195 5:83262725-83262747 ATACTATTTAGTATTTTTATTGG - Intronic
993663972 5:90672044-90672066 AAGCAATATAGTATATTTGGTGG - Intronic
993988935 5:94632424-94632446 ATGCAAACTGGTATTTTGATTGG + Intronic
994026103 5:95086154-95086176 ATGCAATCTAACATTATTGTTGG - Intronic
994348148 5:98712798-98712820 ATGCTAGCAATTATTTTTGTAGG - Intergenic
994910775 5:105903385-105903407 ATGGAACCTAGTATTTCTTTTGG + Intergenic
996303491 5:122017702-122017724 ATGCAAGCTATTCTGTTTGTAGG - Intronic
996428964 5:123349071-123349093 ATGAATTCTAGTCTTTTTGGAGG - Intronic
997632821 5:135382533-135382555 ATGTTATCTAGGATTTTTATGGG - Intronic
998465318 5:142339208-142339230 ATGCTGTCTATTGTTTTTGTTGG + Intergenic
1005557916 6:27007122-27007144 AGGCAATCTAGTAGTCTTCTGGG + Intergenic
1006002318 6:30974877-30974899 ATGCAGTCTTGTAAATTTGTAGG + Intergenic
1007263785 6:40582357-40582379 TTGCAATCTCGTATGTTTTTGGG + Intronic
1007948388 6:45846886-45846908 ATGCATTCTCCTATTTTTGAGGG + Intergenic
1008998151 6:57682820-57682842 ATGGTACCTTGTATTTTTGTGGG - Intergenic
1009186647 6:60582182-60582204 ATGGTACCTTGTATTTTTGTGGG - Intergenic
1009302237 6:62039678-62039700 GTTCAATATGGTATTTTTGTGGG - Intronic
1010967611 6:82229787-82229809 ATGAAAGCTAATATTCTTGTGGG - Intronic
1011021935 6:82824181-82824203 GTTCATTTTAGTATTTTTGTGGG - Intergenic
1011513373 6:88125955-88125977 TTGCCATCTTGTATTTTTGTGGG + Intergenic
1011863980 6:91797702-91797724 ATGCAATGTAATATTTTAGGGGG - Intergenic
1012669724 6:102028514-102028536 ATACATTCTAGTATTTTTAGTGG + Intronic
1012813444 6:103990372-103990394 AACCAAGCTAGGATTTTTGTAGG + Intergenic
1013477639 6:110523817-110523839 ATACAATCTGGAATTTTTATTGG + Intergenic
1016326493 6:142908456-142908478 ATGCAATCTAATATTGTTAATGG - Intronic
1016599014 6:145835399-145835421 ATTCAATCAACAATTTTTGTGGG - Intergenic
1016818894 6:148328829-148328851 AAGCATTTTACTATTTTTGTTGG + Intronic
1018557869 6:165067364-165067386 TTGAAATCTACTATTATTGTGGG - Intergenic
1022682372 7:32561225-32561247 ATGCCATCTAGGACTTTTGTAGG - Intronic
1022701618 7:32765977-32765999 ATGCAATGTAATTTTTATGTGGG - Intergenic
1022937203 7:35190556-35190578 ATGCAATGTAATTTTTATGTGGG - Intergenic
1024387029 7:48763930-48763952 GTGCAATTTAGGATTTTTTTGGG + Intergenic
1027741979 7:82019926-82019948 ATCCAATCTAGTATTTTCATAGG - Intronic
1028174347 7:87636260-87636282 AGCCAATCTTGTATGTTTGTTGG + Intronic
1028372921 7:90115047-90115069 ATGCAATGTAATTTTTATGTGGG + Intergenic
1028862991 7:95675836-95675858 ATGCAATCGTGTAATTTTCTTGG + Intergenic
1029833366 7:103283198-103283220 ATGCAATGTAATTTTTATGTGGG - Intergenic
1030989699 7:116285390-116285412 TTGCAGTCTATTATTTTTCTGGG + Intergenic
1031253963 7:119423936-119423958 ATGTCATCTAGTTGTTTTGTGGG - Intergenic
1039209459 8:35196163-35196185 ATGCATTCTAGTAAAGTTGTTGG + Intergenic
1039253517 8:35692610-35692632 ACTCAATCTAGACTTTTTGTTGG + Intronic
1039682089 8:39751444-39751466 CTGCAATGAAGTGTTTTTGTGGG + Intronic
1042734456 8:71972110-71972132 CTGAAATGTAATATTTTTGTAGG + Intronic
1043000405 8:74752676-74752698 TAGCAATCTAGCATTTTTCTAGG - Intronic
1046171540 8:110514462-110514484 ATGCTAGTTAGTATTTCTGTGGG + Intergenic
1046367151 8:113249631-113249653 ATGGCATATAATATTTTTGTTGG + Intronic
1047826751 8:128584561-128584583 AGGCAACCTAGTTTCTTTGTTGG - Intergenic
1048086060 8:131180856-131180878 ATGCAGTGTGGTATTTCTGTGGG + Intergenic
1051077664 9:13259663-13259685 ATGCACTCTTGCATTTATGTGGG - Intronic
1052379400 9:27753755-27753777 ATGAAATCAAGTGTTTTTGAAGG + Intergenic
1054853390 9:69872193-69872215 ATGCAATGTAGTATTTAGGTTGG - Intronic
1058205965 9:102107991-102108013 ATGCAATCTTACATTTTTCTAGG + Intergenic
1058925839 9:109662978-109663000 ATGATAGCTTGTATTTTTGTGGG + Intronic
1059345035 9:113622262-113622284 GTGCCATTTATTATTTTTGTTGG + Intergenic
1060388590 9:123258205-123258227 ATGAAAGCAAGGATTTTTGTTGG - Intronic
1061343834 9:130005732-130005754 ATGTAATTTATTCTTTTTGTGGG - Intronic
1061890926 9:133618839-133618861 AACCCATCTAGAATTTTTGTGGG + Intergenic
1186126264 X:6417833-6417855 ATGCAATATTTTATTTTTGAAGG + Intergenic
1186171466 X:6881750-6881772 ATTCACTCTTGTTTTTTTGTAGG - Intergenic
1188029145 X:25245137-25245159 TAGCTATCTAGTATTTTTGGTGG + Intergenic
1188616905 X:32168560-32168582 AGGGAATTTAGTTTTTTTGTTGG - Intronic
1190965481 X:55296364-55296386 ATGCTAGTTTGTATTTTTGTGGG + Intergenic
1191261025 X:58321523-58321545 CTTCAATCTAGTTTTTTTCTGGG - Intergenic
1193998505 X:88396861-88396883 ATGCAAACTAGTATATATTTAGG + Intergenic
1195396626 X:104417616-104417638 ACGCTTGCTAGTATTTTTGTTGG - Intergenic
1196169979 X:112576409-112576431 ATCCAAACTAGTAATTTTGCTGG + Intergenic
1197964256 X:132040534-132040556 ATACATTTTAGTATTTTTCTCGG + Intergenic
1198039142 X:132832088-132832110 ATACAATCTATTATTTCTATTGG - Intronic
1200013839 X:153143296-153143318 ATACCATCTAGGACTTTTGTAGG + Intergenic
1200025762 X:153256659-153256681 ATACCATCTAGGACTTTTGTAGG - Intergenic
1200599270 Y:5186220-5186242 ATTCATTCTAGTAATTTTTTTGG - Intronic
1200710277 Y:6477171-6477193 ATGCAATATAGTAACTTAGTTGG - Intergenic
1200940719 Y:8777360-8777382 ATGCAATTTAGTAACTTAGTTGG - Intergenic
1201023837 Y:9687537-9687559 ATGCAATATAGTAACTTAGTTGG + Intergenic