ID: 991936424

View in Genome Browser
Species Human (GRCh38)
Location 5:71806110-71806132
Sequence GAATCACAACAAGCGCTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991936424_991936425 -2 Left 991936424 5:71806110-71806132 CCATTAAGCGCTTGTTGTGATTC No data
Right 991936425 5:71806131-71806153 TCAGCGTAGATTTTTGCCTAAGG No data
991936424_991936427 28 Left 991936424 5:71806110-71806132 CCATTAAGCGCTTGTTGTGATTC No data
Right 991936427 5:71806161-71806183 TGTTTCTGAGAATTGTAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991936424 Original CRISPR GAATCACAACAAGCGCTTAA TGG (reversed) Intergenic
No off target data available for this crispr