ID: 991937733

View in Genome Browser
Species Human (GRCh38)
Location 5:71818403-71818425
Sequence AGGGACCCAAAACATGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991937733_991937740 27 Left 991937733 5:71818403-71818425 CCCTGCTCATGTTTTGGGTCCCT No data
Right 991937740 5:71818453-71818475 CCAAGAGCCCTTGAAAAATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991937733 Original CRISPR AGGGACCCAAAACATGAGCA GGG (reversed) Intergenic
No off target data available for this crispr