ID: 991939304

View in Genome Browser
Species Human (GRCh38)
Location 5:71835069-71835091
Sequence ATCTGAATATGTAAAGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991939303_991939304 15 Left 991939303 5:71835031-71835053 CCATTTTAACTGTGACACTTCAC No data
Right 991939304 5:71835069-71835091 ATCTGAATATGTAAAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991939304 Original CRISPR ATCTGAATATGTAAAGAAGT TGG Intergenic
No off target data available for this crispr