ID: 991940886

View in Genome Browser
Species Human (GRCh38)
Location 5:71850933-71850955
Sequence CCGATCCCGGAGAAGCCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991940879_991940886 27 Left 991940879 5:71850883-71850905 CCTCTTGAACACTTTGCTGCTTA 0: 116
1: 196
2: 1343
3: 1214
4: 930
Right 991940886 5:71850933-71850955 CCGATCCCGGAGAAGCCGGCGGG No data
991940881_991940886 -6 Left 991940881 5:71850916-71850938 CCAGTGCGGTAACGTGACCGATC No data
Right 991940886 5:71850933-71850955 CCGATCCCGGAGAAGCCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991940886 Original CRISPR CCGATCCCGGAGAAGCCGGC GGG Intergenic
No off target data available for this crispr